Gene Page: ADRA2C

Summary
GeneID  152
Symbol  ADRA2C
Synonyms  ADRA2L2|ADRA2RL2|ADRARL2|ALPHA2CAR
Description  adrenergic, alpha-2C-, receptor
See related  HGNC:283|MIM:104250|HPRD:00085|
Locus tag  -
Gene type  protein-coding
Map location  4p16
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0004872receptor activityIEA-
GO:0005515protein bindingIEA-
GO:0004938alpha2-adrenergic receptor activityTAS9371698 
GO:0004935adrenoceptor activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0000187activation of MAPK activityTAS10196213 
GO:0007186G-protein coupled receptor protein signaling pathwayTAS9371698 
GO:0007267cell-cell signalingTAS9371698 
GO:0007165signal transductionIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005768endosomeTAS10196213 
GO:0005886plasma membraneIEA-
GO:0005887integral to plasma membraneTAS9371698 
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
EIF2B1EIF-2B | EIF-2Balpha | EIF2B | EIF2BA | MGC117409 | MGC125868 | MGC125869eukaryotic translation initiation factor 2B, subunit 1 alpha, 26kDa-HPRD,BioGRID9235896 
GNAO1DKFZp686O0962 | G-ALPHA-o | GNAOguanine nucleotide binding protein (G protein), alpha activating activity polypeptide O-HPRD1349607 
PPP1R9BFLJ30345 | PPP1R6 | PPP1R9 | SPINO | Spnprotein phosphatase 1, regulatory (inhibitor) subunit 9BReconstituted ComplexBioGRID11154706 
YWHAZKCIP-1 | MGC111427 | MGC126532 | MGC138156tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide-HPRD10224112 
 
Pathway annotation
Pathway namePathway size# SZGR genes in pathwayInfo
KEGG_NEUROACTIVE_LIGAND_RECEPTOR_INTERACTION 272195All SZGR genes in this pathway
DAVICIONI_MOLECULAR_ARMS_VS_ERMS_UP 332228All SZGR genes in this pathway
GAUSSMANN_MLL_AF4_FUSION_TARGETS_D_UP 3823All SZGR genes in this pathway
HAMAI_APOPTOSIS_VIA_TRAIL_DN 186107All SZGR genes in this pathway
LIN_APC_TARGETS 7755All SZGR genes in this pathway
HANSON_HRAS_SIGNALING_VIA_NFKB 2214All SZGR genes in this pathway
STEIN_ESRRA_TARGETS_DN 10563All SZGR genes in this pathway
WALLACE_PROSTATE_CANCER_RACE_UP 299167All SZGR genes in this pathway
RIZKI_TUMOR_INVASIVENESS_3D_UP 210124All SZGR genes in this pathway
MEISSNER_BRAIN_HCP_WITH_H3K4ME3_AND_H3K27ME3 1069729All SZGR genes in this pathway
VALK_AML_CLUSTER_13 3020All SZGR genes in this pathway
YAGI_AML_WITH_T_8_21_TRANSLOCATION 368247All SZGR genes in this pathway
MEISSNER_NPC_HCP_WITH_H3K4ME2_AND_H3K27ME3 349234All SZGR genes in this pathway
MIKKELSEN_MCV6_HCP_WITH_H3K27ME3 435318All SZGR genes in this pathway
STEIN_ESRRA_TARGETS 535325All SZGR genes in this pathway
MIKKELSEN_NPC_HCP_WITH_H3K27ME3 341243All SZGR genes in this pathway
MIKKELSEN_MEF_HCP_WITH_H3K27ME3 590403All SZGR genes in this pathway
YAO_TEMPORAL_RESPONSE_TO_PROGESTERONE_CLUSTER_6 7548All SZGR genes in this pathway
MARTENS_TRETINOIN_RESPONSE_UP 857456All SZGR genes in this pathway
ZWANG_TRANSIENTLY_UP_BY_2ND_EGF_PULSE_ONLY 1725838All SZGR genes in this pathway
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1824724791A,m8hsa-miR-182UUUGGCAAUGGUAGAACUCACA
miR-964734791Ahsa-miR-96brainUUUGGCACUAGCACAUUUUUGC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.