Gene Page: COCH

Summary
GeneID  1690
Symbol  COCH
Synonyms  COCH-5B2|COCH5B2|DFNA9
Description  coagulation factor C homolog, cochlin (Limulus polyphemus)
See related  HGNC:2180|MIM:603196|Ensembl:ENSG00000100473|HPRD:04431|
Locus tag  -
Gene type  protein-coding
Map location  14q12-q13
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.047 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007605sensory perception of soundTAS9806553 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005576extracellular regionIEA-
GO:0005578proteinaceous extracellular matrixIEA-
 
Pathway annotation
Pathway namePathway size# SZGR genes in pathwayInfo
LIU_PROSTATE_CANCER_DN 481290All SZGR genes in this pathway
SAMOLS_TARGETS_OF_KHSV_MIRNAS_UP 87All SZGR genes in this pathway
GAL_LEUKEMIC_STEM_CELL_DN 244153All SZGR genes in this pathway
TONKS_TARGETS_OF_RUNX1_RUNX1T1_FUSION_HSC_UP 185126All SZGR genes in this pathway
LEE_NEURAL_CREST_STEM_CELL_DN 11879All SZGR genes in this pathway
KORKOLA_YOLK_SAC_TUMOR 6233All SZGR genes in this pathway
NUYTTEN_NIPP1_TARGETS_DN 848527All SZGR genes in this pathway
NUYTTEN_EZH2_TARGETS_DN 1024594All SZGR genes in this pathway
LOCKWOOD_AMPLIFIED_IN_LUNG_CANCER 214139All SZGR genes in this pathway
RICKMAN_TUMOR_DIFFERENTIATED_WELL_VS_POORLY_DN 382224All SZGR genes in this pathway
KOYAMA_SEMA3B_TARGETS_DN 411249All SZGR genes in this pathway
RICKMAN_HEAD_AND_NECK_CANCER_B 4822All SZGR genes in this pathway
BENPORATH_ES_1 379235All SZGR genes in this pathway
BENPORATH_SUZ12_TARGETS 1038678All SZGR genes in this pathway
BENPORATH_EED_TARGETS 1062725All SZGR genes in this pathway
GEORGES_TARGETS_OF_MIR192_AND_MIR215 893528All SZGR genes in this pathway
ALCALAY_AML_BY_NPM1_LOCALIZATION_UP 14083All SZGR genes in this pathway
ABE_INNER_EAR 4826All SZGR genes in this pathway
CREIGHTON_ENDOCRINE_THERAPY_RESISTANCE_2 473224All SZGR genes in this pathway
YEGNASUBRAMANIAN_PROSTATE_CANCER 12860All SZGR genes in this pathway
MCCABE_BOUND_BY_HOXC6 469239All SZGR genes in this pathway
VICENT_METASTASIS_UP 1411All SZGR genes in this pathway
ACEVEDO_LIVER_CANCER_WITH_H3K27ME3_DN 228114All SZGR genes in this pathway
SMID_BREAST_CANCER_RELAPSE_IN_BONE_DN 315197All SZGR genes in this pathway
SMID_BREAST_CANCER_BASAL_UP 648398All SZGR genes in this pathway
BOCHKIS_FOXA2_TARGETS 425261All SZGR genes in this pathway
BOQUEST_STEM_CELL_CULTURED_VS_FRESH_UP 425298All SZGR genes in this pathway
BLUM_RESPONSE_TO_SALIRASIB_DN 342220All SZGR genes in this pathway
MEISSNER_NPC_HCP_WITH_H3K4ME3_AND_H3K27ME3 142103All SZGR genes in this pathway
MEISSNER_BRAIN_HCP_WITH_H3K4ME3_AND_H3K27ME3 1069729All SZGR genes in this pathway
BOYAULT_LIVER_CANCER_SUBCLASS_G23_UP 5235All SZGR genes in this pathway
MIKKELSEN_NPC_HCP_WITH_H3K4ME3_AND_H3K27ME3 210148All SZGR genes in this pathway
MARTENS_TRETINOIN_RESPONSE_DN 841431All SZGR genes in this pathway
FIGUEROA_AML_METHYLATION_CLUSTER_3_UP 17097All SZGR genes in this pathway
FIGUEROA_AML_METHYLATION_CLUSTER_4_UP 11264All SZGR genes in this pathway
FIGUEROA_AML_METHYLATION_CLUSTER_6_UP 14081All SZGR genes in this pathway
FIGUEROA_AML_METHYLATION_CLUSTER_7_UP 11868All SZGR genes in this pathway
WIERENGA_STAT5A_TARGETS_UP 217131All SZGR genes in this pathway
WIERENGA_STAT5A_TARGETS_GROUP2 6038All SZGR genes in this pathway
JOHNSTONE_PARVB_TARGETS_3_DN 918550All SZGR genes in this pathway
BRUINS_UVC_RESPONSE_VIA_TP53_GROUP_C 9260All SZGR genes in this pathway
KATSANOU_ELAVL1_TARGETS_DN 14888All SZGR genes in this pathway
NABA_ECM_GLYCOPROTEINS 19699All SZGR genes in this pathway
NABA_CORE_MATRISOME 275148All SZGR genes in this pathway
NABA_MATRISOME 1028559All SZGR genes in this pathway
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1377978041A,m8hsa-miR-137UAUUGCUUAAGAAUACGCGUAG
miR-3782342401Ahsa-miR-378CUCCUGACUCCAGGUCCUGUGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.