Gene Page: CNIH4

Summary
GeneID  29097
Symbol  CNIH4
Synonyms  HSPC163
Description  cornichon homolog 4 (Drosophila)
See related  HGNC:25013|Ensembl:ENSG00000143771|HPRD:13709|
Locus tag  -
Gene type  protein-coding
Map location  1q42.11
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
ExpressionExpressionP value: 2.719 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIPI17353931 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007242intracellular signaling cascadeIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005783endoplasmic reticulumIDA11256614 
GO:0016020membraneIEA-
GO:0016021integral to membraneIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
TOR1ADQ2 | DYT1torsin family 1, member A (torsin A)Affinity Capture-MSBioGRID17353931 
 
Pathway annotation
Pathway namePathway size# SZGR genes in pathwayInfo
WINTER_HYPOXIA_UP 9257All SZGR genes in this pathway
ONKEN_UVEAL_MELANOMA_UP 783507All SZGR genes in this pathway
CASORELLI_APL_SECONDARY_VS_DE_NOVO_UP 3925All SZGR genes in this pathway
LAIHO_COLORECTAL_CANCER_SERRATED_UP 11271All SZGR genes in this pathway
MULLIGHAN_MLL_SIGNATURE_1_UP 380236All SZGR genes in this pathway
MULLIGHAN_MLL_SIGNATURE_2_UP 418263All SZGR genes in this pathway
KINSEY_TARGETS_OF_EWSR1_FLII_FUSION_UP 1278748All SZGR genes in this pathway
DODD_NASOPHARYNGEAL_CARCINOMA_DN 1375806All SZGR genes in this pathway
PEREZ_TP53_TARGETS 1174695All SZGR genes in this pathway
PATIL_LIVER_CANCER 747453All SZGR genes in this pathway
NUYTTEN_NIPP1_TARGETS_UP 769437All SZGR genes in this pathway
BENPORATH_CYCLING_GENES 648385All SZGR genes in this pathway
BENPORATH_PROLIFERATION 14780All SZGR genes in this pathway
DOUGLAS_BMI1_TARGETS_UP 566371All SZGR genes in this pathway
MASSARWEH_TAMOXIFEN_RESISTANCE_UP 578341All SZGR genes in this pathway
ACEVEDO_LIVER_CANCER_UP 973570All SZGR genes in this pathway
ACEVEDO_LIVER_TUMOR_VS_NORMAL_ADJACENT_TISSUE_UP 863514All SZGR genes in this pathway
EHLERS_ANEUPLOIDY_DN 128All SZGR genes in this pathway
WHITFIELD_CELL_CYCLE_M_G1 14895All SZGR genes in this pathway
JOHNSTONE_PARVB_TARGETS_3_UP 430288All SZGR genes in this pathway
KOINUMA_TARGETS_OF_SMAD2_OR_SMAD3 824528All SZGR genes in this pathway
DELACROIX_RARG_BOUND_MEF 367231All SZGR genes in this pathway
RATTENBACHER_BOUND_BY_CELF1 467251All SZGR genes in this pathway
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-3751151211Ahsa-miR-375UUUGUUCGUUCGGCUCGCGUGA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.