4089

SMAD4

DPC4|JIP|MADH4|MYHRS;SMAD family member 4;SMAD4;SMAD family member 4

MAD homolog 4|SMAD, mothers against DPP homolog 4|deleted in pancreatic carcinoma locus 4|deletion target in pancreatic carcinoma 4|mothers against decapentaplegic homolog 4|mothers against decapentaplegic, Drosophila, homolog of, 4

18q21.1

protein-coding

The tumor suppressor SMAD4, also known as DPC4, deleted in pancreatic cancer, is a central mediator of TGF-beta signaling. It was previously shown that mice homozygous for a null mutation of Smad4 (Smad4-/-) died prior to gastrulation displaying impaired extraembryonic membrane formation and endoderm differentiation. Here we show that Smad4+/- mice began to develop polyposis in the fundus and antrum when they were over 6 - 12 months old, and in the duodenum and cecum in older animals at a lower frequency. With increasing age, polyps in the antrum show sequential changes from hyperplasia, to dysplasia, in-situ carcinoma, and finally invasion. These alterations are initiated by a dramatic expansion of the gastric epithelium where Smad4 is expressed. However, loss of the remaining Smad4 wild-type allele was detected only in later stages of tumor progression, suggesting that haploinsufficiency of Smad4 is sufficient for tumor initiation. Our data also showed that overexpression of TGF-beta1 and Cyclin D1 was associated with increased proliferation of gastric polyps and tumors. These studies demonstrate that Smad4 functions as a tumor suppressor in the gastrointestinal tract and also provide a valuable model for screening factors that promote or prevent gastric tumorigenesis.

Here, we report the complete genomic sequence and the characterization of the 311-kb region of 18q21, a candidate tumor suppressor locus containing a region of homozygous deletion in a lung cancer cell line, Ma29. This region contained two known genes, SMAD4 and ME2 (mitochondrial malate oxydoreductase), and two novel genes, D29 (deleted in Ma29 HGMW-approved symbol ELAC1), encoding an evolutionarily conserved protein, and B29 (beside the Ma29 deletion HGMW-approved symbol C18orf3), with no significant homology to any known genes. The deleted DNA segment in Ma29, which was estimated to be 195 kb in size, included all the coding exons of ME2 and D29, but not the coding exons of SMAD4 and B29. The deleted region also included exon 0, a 5-noncoding exon, of SMAD4, and the expression of SMAD4 was greatly reduced in Ma29 cells. mutations of SMAD4 and D29 were detected in 1 of 45 lung cancer cell lines examined, while those of ME2 and B29 were not detected, indicating that these four genes are not major targets for 18q21 deletions. The physical and transcriptional map constructed in this study will provide basic information for the identification of a tumor suppressor gene(s) at 18q21 involved in lung carcinogenesis.

Smad proteins have been demonstrated to be key components in the transforming growth factor beta signaling cascade. Here we demonstrate that Smad4, together with Smad3, can interact with the androgen receptor (AR) in the DNA-binding and ligand-binding domains, which may result in the modulation of 5alpha-dihydrotestosterone-induced AR transactivation. Interestingly, in the prostate PC3 and LNCaP cells, addition of Smad3 can enhance AR transactivation, and co-transfection of Smad3 and Smad4 can then repress AR transactivation in various androgen response element-promoter reporter assays as well as Northern blot and reverse transcription-PCR quantitation assays with prostate-specific antigen mRNA expression. In contrast, in the SW480.C7 cells, lacking endogenous functional Smad4, the influence of Smad3 on AR transactivation is dependent on the various androgen response element-promoters. The influence of Smad3/Smad4 on the AR transactivation may involve the acetylation since the treatment of trichostatin A or sodium butyrate can reverse Smad3/Smad4-repressed AR transactivation and Smad3/Smad4 complex can also decrease the acetylation level of AR. Together, these results suggest that the interactions between AR, Smad3, and Smad4 may result in the differential regulation of the AR transactivation, which further strengthens their roles in the prostate cancer progression.

Smads are important intracellular effectors in signaling pathways of the transforming growth factor-beta (TGF-beta) superfamily. Upon activation by TGF-beta, receptor-phosphorylated Smads form a complex with tumor suppressor Smad4/DPC4, and the Smad complexes then are imported into the nucleus. Although diverse pathways regulate the activity and expression of receptor-phosphorylated and inhibitory Smads, cellular factors modulating the activity of the common Smad4 remain unidentified. Here we describe the involvement of the small ubiquitin-like modifier-1 (SUMO-1) conjugation pathway in regulating the growth inhibitory and transcriptional responses of Smad4. The MH1 domain of Smad4 was shown to associate physically with Ubc9, the ubiquitin carrier protein (E2) conjugating enzyme in sumoylation. In cultured cells, Smad4 is modified by SUMO-1 at the endogenous level. The sumoylation sites were identified as two evolutionarily conserved lysine residues, Lys-113 and Lys-159, in the MH1 domain. We found that the mutations at Lys-113 and Lys-159 did not alter the ability of Smad4 to form a complex with Smad2 and FAST on the Mix.2 promoter. Importantly, SUMO-1 overexpression enhanced TGF-beta-induced transcriptional responses. These findings identify sumoylation as a unique mechanism to modulate Smad4-dependent cellular responses.

Smad4 is an essential signal transducer of all transforming growth factor-beta (TGF-beta) superfamily pathways that regulate cell growth and differentiation, and it becomes inactivated in human cancers. Receptor-activated (R-) Smads can be poly-ubiquitinated in the cytoplasm or the nucleus, and this regulates their steady state levels or shutdown of the signaling pathway. Oncogenic mutations in Smad4 and other Smads have been linked to protein destabilization and proteasomal degradation. We analyzed a panel of missense mutants derived from human cancers that map in the N-terminal Mad homology (MH) 1 domain of Smad4 and result in protein instability. We demonstrate that all mutants exhibit enhanced poly-ubiquitination and proteasomal degradation. In contrast, wild type Smad4 is a relatively stable protein that undergoes mono- or oligo-ubiquitination, a modification not linked to protein degradation. Analysis of Smad4 deletion mutants indicated efficient mono- or oligo-ubiquitination of the C-terminal MH2 domain. Mass spectrometric analysis of mono-ubiquitinated Smad4 MH2 domain identified lysine 507 as a major target for ubiquitination. Lysine 507 resides in the conserved L3 loop of Smad4 and participates in R-Smad C-terminal phosphoserine recognition. Mono- or oligo-ubiquitinated Smad4 exhibited enhanced ability to oligomerize with R-Smads, whereas mutagenesis of lysine 507 led to inefficient Smad4/R-Smad hetero-oligomerization and defective transcriptional activity. Finally, overexpression of a mutant ubiquitin that only leads to mono-ubiquitination of Smad4 enhanced Smad transcriptional activity. These data suggest that oligo-ubiquitination positively regulates Smad4 function, whereas poly-ubiquitination primarily occurs in unstable cancer mutants and leads to protein degradation.

tumor suppressor Smad4/DPC4 is a central intracellular signal transducer for transforming growth factor-beta (TGF-beta) signaling. We recently reported that transcriptional potential of Smad4 was regulated by SUMOylation in transfected HeLa cells (1), but the precise mechanism and function of Smad4 SUMOylation in TGF-beta signaling remain to be elucidated. Here, we describe the regulation of TGF-beta signaling by SUMOylation through the control of Smad4 metabolic stability and subcellular localization. We found that SUMO-1 overexpression strongly increases Smad4 levels, while inhibition of SUMOylation by small interfering RNA (siRNA)-mediated knockdown of the E2 enzyme Ubc9 reduces endogenous Smad4 levels. Concomitantly, SUMO-1 overexpression enhances and Ubc9 knockdown reduces levels of intranuclear Smad4, growth inhibitory response, as well as transcriptional responses to TGF-beta. Comparison of wild type and mutant forms of Smad4 for SUMOylation, ubiquitination, and half-life allows the conclusion that SUMO-1 modification serves to protect Smad4 from ubiquitin-dependent degradation and consequently enhances the growth inhibitory and transcriptional responses of Smad4.

Loss of heterozygosity (LOH) of loci on chromosome 18q occurs in a majority of colorectal cancers. The DPC4 (Smad4) tumor suppressor gene, located at 18q21.1, may be a predisposing gene for Juvenile Polyposis Syndrome. To investigate alterations of the DPC4 gene in sporadic colon adenocarcinoma, a panel of 60 tumor specimens from Croatian patients was surveyed for evidence of LOH and also for mutations within the entire DPC4 coding region (exons 1-11). Using three pairs of specific primers for the three DPC4 microsatellite repetitive sequences, we investigated the frequency of LOH. The presence of single nucleotide change at restriction sites of specific codons in exons 2, 8, 10, and 11 (which belong to the conserved region of the gene) was examined by RFLP analysis. The investigation was extended to search for any other mutation within the entire coding region of the DPC4 gene by single strand conformation polymorphism (SSCP) analysis. Our results show a high frequency of heterozygosity in 58 of 60 (97%) colon adenocarcinoma samples. LOH at any one of the three flanking markers was observed in 26 (45%) of the 58 informative cases. The loss of one allele of the DPC4 gene was negatively correlated with tumor size; more frequent in smaller tumors (<5 cm) than in larger ones. A mutation was found in exon 11 in only one tumor sample (T18), and the mutation was verified by sequencing. Sequencing demonstrated a novel mutation-a deletion in exon 11 (134-153 del TAGACGAAGTACTTCATACC) of the DPC4 gene in the MH2 domain. These data suggest that inactivation of the DPC4 gene contributes to the genesis of colorectal carcinoma through allelic loss whereas mutation in the coding region of the DPC4 gene is infrequently detected in Croatian patients with A, B or C stages of colorectal cancers.

The aim of this study was to investigate the alterations in the DPC4 tumor suppressor gene in renal cell carcinoma (RCC). The study included 32 tumor specimens from Croatian patients with a diagnosis of RCC. Loss of heterozygosity (LOH) was investigated using three specific oligonucleotide primers for the three DPC4 polymorphic markers. Our investigation of mutations in the DPC4 gene was focused on exons 2, 8, 10 and 11. These exons belong to the mad homology domains 1 (exon 2) and 2 (exons 8-11). The presence of previously documented mutation in exons 2 (codon 100), 8 (codon 358), 10 (codon 412), and 11 (codon 493) was investigated by restriction fragment length polymorphism (RFLP) analysis, as a first screening method. Finally, the study was extended to search for any other type of mutation in the four selected exons by single strand conformation polymorphism (SSCP) assay. To increase heterozygosity, all 32 tumor specimens were tested with primers for three polymorphic markers. A total of 30 (94%) were heterozygous (informative). LOH at any of these markers was only revealed in four (13%) of the 30 informative samples. No tumor samples were positive for mutation in the four investigated exons analyzed by RFLP. In addition, no samples showed other types of mutation in denaturing conditions. genetic alterations were shown only in a minority of patients, probably because mutation analysis of the DPC4 gene has only been partially covered by our work. It seems that exon 2 (belonging to the MH1 domain) and exons 8, 10, 11 (belonging to the MH2 domain) are not altered in RCC. This investigation must be extended on other exons of DPC4 for a better understanding a role of this gene in renal cell carcinoma.

Smad4 mediates signaling by the transforming growth factor-beta (TGF-beta) superfamily of cytokines. Smad signaling is negatively regulated by inhibitory (I) Smads and ubiquitin-mediated processes. Known mechanisms of proteasomal degradation of Smads depend on the direct interaction of specific E3 ligases with Smads. Alternatively, I-Smads elicit degradation of the TGF-beta receptor by recruiting the WW and HECT domain E3 ligases, Smurfs, WWP1, or NEDD4-2. We describe an equivalent mechanism of degradation of Smad4 by the above E3 ligases, via formation of ternary complexes between Smad4 and Smurfs, mediated by R-Smads (Smad2) or I-Smads (Smad6/7), acting as adaptors. Smurfs, which otherwise cannot directly bind to Smad4, mediated poly-ubiquitination of Smad4 in the presence of Smad6 or Smad7. Smad4 co-localized with Smad7 and Smurf1 primarily in the cytoplasm and in peripheral cell protrusions. Smad2 or Smad7 mutants defective in Smad4 interaction failed to induce Smurf1-mediated down-regulation of Smad4. A Smad4 mutant defective in Smad2 or Smad7 interaction could not be effectively down-regulated by Smurf1. We propose that Smad4 is targeted for degradation by multiple ubiquitin ligases that can simultaneously act on R-Smads and signaling receptors. Such mechanisms of down-regulation of TGF-beta signaling may be critical for proper physiological response to this pathway.

TGF-beta can signal by means of Smad transcription factors, which are quintessential tumor suppressors that inhibit cell proliferation, and by means of Smad-independent mechanisms, which have been implicated in tumor progression. Although Smad mutations disable this tumor-suppressive pathway in certain cancers, breast cancer cells frequently evade the cytostatic action of TGF-beta while retaining Smad function. Through immunohistochemical analysis of human breast cancer bone metastases and functional imaging of the Smad pathway in a mouse xenograft model, we provide evidence for active Smad signaling in human and mouse bone-metastatic lesions. genetic depletion experiments further demonstrate that Smad4 contributes to the formation of osteolytic bone metastases and is essential for the induction of IL-11, a gene implicated in bone metastasis in this mouse model system. Activator protein-1 is a key participant in Smad-dependent transcriptional activation of IL-11 and its overexpression in bone-metastatic cells. Our findings provide functional evidence for a switch of the Smad pathway, from tumor-suppressor to prometastatic, in the development of breast cancer bone metastasis.

The tumor suppressor Smad4 is involved in carcinogenesis mainly of the pancreas and colon. Functional inactivation of Smad4 is a genetically late event that occurs upon transition from premalignant stages to invasive and metastatic growth. Smad4 encodes an intracellular messenger common to all signalling cascades induced by members of the transforming growth factor-beta (TGF-beta) superfamily of cytokines. Despite extensive knowledge about the mechanisms of TGF-beta/Smad signal transduction, little is known about Smad4 targets involved in the transition to malignancy. The hallmark of invasive growth is a breakdown of the basement membrane (BM), a specialized sheet of extracellular matrix produced through cooperation of epithelial and stromal cells. Laminin-5, a heterotrimeric epithelial-derived BM component, is commonly lost in carcinomas but not in premalignant tumors. Herein, we report that in human colon and pancreatic tumor cells, Smad4 functions as a positive transcriptional regulator of all three genes encoding laminin-5. Coordinate re-expression of the three laminin-5 chains induced by reconstitution of Smad4 leads to secretion and deposition of the heterotrimeric molecule in BM-like structures. These data define the expression control of an essential BM component as a novel function for the tumor suppressor Smad4.

SMAD4 is inactivated in the majority of pancreatic ductal adenocarcinomas (PDAC) with concurrent mutational inactivation of the INK4A/ARF tumor suppressor locus and activation of the KRAS oncogene. Here, using genetically engineered mice, we determined the impact of SMAD4 deficiency on the development of the pancreas and on the initiation and/or progression of PDAC-alone or in combination with PDAC--relevant mutations. Selective SMAD4 deletion in the pancreatic epithelium had no discernable impact on pancreatic development or physiology. However, when combined with the activated KRAS(G12D) allele, SMAD4 deficiency enabled rapid progression of KRAS(G12D)-initiated neoplasms. While KRAS(G12D) alone elicited premalignant pancreatic intraepithelial neoplasia (PanIN) that progressed slowly to carcinoma, the combination of KRAS(G12D) and SMAD4 deficiency resulted in the rapid development of tumors resembling intraductal papillary mucinous neoplasia (IPMN), a precursor to PDAC in humans. SMAD4 deficiency also accelerated PDAC development of KRAS(G12D) INK4A/ARF heterozygous mice and altered the tumor phenotype; while tumors with intact SMAD4 frequently exhibited epithelial-to-mesenchymal transition (EMT), PDAC null for SMAD4 retained a differentiated histopathology with increased expression of epithelial markers. SMAD4 status in PDAC cell lines was associated with differential responses to transforming growth factor-beta (TGF-beta) in vitro with a subset of SMAD4 wild-type lines showing prominent TGF-beta-induced proliferation and migration. These results provide genetic confirmation that SMAD4 is a PDAC tumor suppressor, functioning to block the progression of KRAS(G12D)-initiated neoplasms, whereas in a subset of advanced tumors, intact SMAD4 facilitates EMT and TGF-beta-dependent growth.

PURPOSE: Mothers against decapentaplegic homologue 4 (SMAD4) is a tumor suppressor gene associated with gastrointestinal carcinogenesis. The aim of the present study is to more precisely characterize its role in the development and progression of human gastric carcinoma. EXPERIMENTAL DESIGN: The expression of SMAD4 was investigated in 283 gastric adenocarcinomas and related lesions, as well as in 9 gastric carcinoma cell lines. We also analyzed the methylation status of SMAD4 gene by using methylation-specific PCR, examined loss of heterozygosity (LOH) of this gene locus by using a vicinal marker, and detected exon mutation of SMAD4 through exon-by-exon amplification. Moreover, we assessed whether MG132, a proteasome inhibitor, affected the SMAD4 protein level. RESULTS: We found loss of SMAD4 protein expression in the cytoplasm (36 of 114, 32%) and in the nucleus (46 of 114, 40%) of gastric cancer cells. The loss of nuclear SMAD4 expression in primary tumors correlated significantly with poor survival, and was an independent prognostic marker in multivariate analysis. We also found a substantial decrease in SMAD4 expression at both the RNA and protein level in several human gastric carcinoma cell lines. In addition, we found that LOH (20 of 70, 29%) and promoter hypermethylation (4 of 73, 5%) were associated with the loss of SMAD4 expression. SMAD4 protein levels were also affected in certain gastric carcinoma cell lines following incubation with MG132. CONCLUSION: Taken together, our results indicate that the loss of SMAD4, especially loss of nuclear SMAD4 expression, is involved in gastric cancer progression. The loss of SMAD4 in gastric carcinomas was due to several mechanisms, including LOH, hypermethylation, and proteasome degradation.

Oncogenic Kras initiates pancreatic tumorigenesis, while subsequent genetic events shape the resultant disease. We show here that concomitant expression of Kras(G12D) and haploinsufficiency of the Smad4/Dpc4 tumor suppressor gene engenders a distinct class of pancreatic tumors, mucinous cystic neoplasms (MCNs), which culminate in invasive ductal adenocarcinomas. Disease evolves along a progression scheme analogous to, but distinct from, the classical PanIN-to-ductal adenocarcinoma sequence, and also portends a markedly different prognosis. Progression of MCNs is accompanied by LOH of Dpc4 and mutation of either p53 or p16. Thus, these distinct phenotypic routes to invasive adenocarcinoma nevertheless share the same overall mutational spectra. Our findings suggest that the sequence, as well as the context, in which these critical mutations are acquired helps determine the ensuing pathology.

AIM: To establish an optimum combination of molecular markers resulting in best overall diagnostic sensitivity and specificity for evaluation of suspicious pancreatic mass. METHODS: Endoscopic ultrasound (EUS)-guided fine needle aspiration cytology (FNA) was performed on 101 consecutive patients (63 males, 38 females, 60 +/- 12 years; 81 with subsequently diagnosed pancreatic cancer, 20 with chronic pancreatitis) with focal pancreatic mass. Samples were evaluated on-site by an experienced cytopathologist. DNA was extracted from Giemsa stained cells selected by laser microdissection and the presence of K-ras, p53 and p16 somatic mutations was tested by cycling-gradient capillary electrophoresis (CGCE) and single-strand conformation polymorphism (SSCP) techniques. In addition, allelic losses of tumor suppressor genes p16 (INK4, CDKN2A) and DPC4 (MADH4, SMAD4) were detected by monitoring the loss of heterozygosity (LOH) at 9p and 18q, respectively. RESULTS: Sensitivity and specificity of EUS-guided FNA were 75% and 85%, positive and negative predictive value reached 100%. The remaining 26% samples were assigned as inconclusive. Testing of molecular markers revealed sensitivity and specificity of 70% and 100% for K-ras mutations (P < 0.001), 24% and 90% for p53 mutations (NS), 13% and 100% for p16 mutations (NS), 85% and 64% for allelic losses at 9p (P < 0.001) and 78% and 57% for allelic losses at 18q (P < 0.05). When tests for different molecular markers were combined, the best results were obtained with K-ras + LOH at 9p (92% and 64%, P < 0.001), K-ras + LOH at 18q (92% and 57%, P < 0.001), and K-ras + LOH 9q + LOH 18q (96% and 43%, P < 0.001). When the molecular markers were used as complements to FNA cytology to evaluate inconclusive samples only, the overall sensitivity of cancer detection was 100% in all patients enrolled in the study. CONCLUSION: EUS-guided FNA cytology combined with screening of K-ras mutations and allelic losses of tumor suppressors p16 and DPC4 represents a very sensitive approach in screening for pancreatic malignancy. Molecular markers may find its use particularly in cases where FNA cytology has been inconclusive.

Germline mutations in the adenomatous polyposis coli (APC) gene are responsible for familial adenomatous polyposis (FAP), an autosomal dominant hereditary predisposition to the development of multiple colorectal adenomas and of a broad spectrum of extra-intestinal tumors. Moreover, somatic APC mutations play a rate-limiting and initiating role in the majority of sporadic colorectal cancers. Notwithstanding its multifunctional nature, the main tumor suppressing activity of the APC gene resides in its ability to regulate Wnt/beta-catenin signaling. Notably, genotype-phenotype correlations have been established at the APC gene between the length and stability of the truncated proteins encoded by different mutant alleles, the corresponding levels of Wnt/beta-catenin signaling activity they encode for, and the incidence and distribution of intestinal and extra-intestinal tumors. Here, we report a novel mouse model, Apc1572T, obtained by targeting a truncated mutation at codon 1572 in the endogenous Apc gene. This hypomorphic mutant allele results in intermediate levels of Wnt/beta-catenin signaling activation when compared with other Apc mutations associated with multifocal intestinal tumors. Notwithstanding the constitutive nature of the mutation, Apc(+/1572T) mice have no predisposition to intestinal cancer but develop multifocal mammary adenocarcinomas and subsequent pulmonary metastases in both genders. The histology of the Apc1572T primary mammary tumours is highly heterogeneous with luminal, myoepithelial, and squamous lineages and is reminiscent of metaplastic carcinoma of the breast in humans. The striking phenotype of Apc(+/1572T) mice suggests that specific dosages of Wnt/beta-catenin signaling activity differentially affect tissue homeostasis and initiate tumorigenesis in an organ-specific fashion.

SMAD4 is localized to chromosome 18q21, a frequent site for loss of heterozygosity in advanced stage colon cancers. Although Smad4 is regarded as a signaling mediator of the TGFbeta signaling pathway, its role as a major suppressor of colorectal cancer progression and the molecular events underlying this phenomenon remain elusive. Here, we describe the establishment and use of colon cancer cell line model systems to dissect the functional roles of TGFbeta and Smad4 inactivation in the manifestation of a malignant phenotype. We found that loss of function of Smad4 and retention of intact TGFbeta receptors could synergistically increase the levels of VEGF, a major proangiogenic factor. Pharmacologic inhibition studies suggest that overactivation of the TGFbeta-induced MEK-Erk and p38-MAPK (mitogen-activated protein kinase) auxiliary pathways are involved in the induction of VEGF expression in SMAD4 null cells. Overall, SMAD4 deficiency was responsible for the enhanced migration of colon cancer cells with a corresponding increase in matrix metalloprotease 9 enhanced hypoxia-induced GLUT1 expression, increased aerobic glycolysis, and resistance to 5-fluoruracil-mediated apoptosis. Interestingly, Smad4 specifically interacts with hypoxia-inducible factor (HIF) 1alpha under hypoxic conditions providing a molecular basis for the differential regulation of target genes to suppress a malignant phenotype. In summary, our results define a molecular mechanism that explains how loss of the tumor suppressor Smad4 promotes colorectal cancer progression. These findings are also consistent with targeting TGFbeta-induced auxiliary pathways, such as MEK-ERK, and p38-MAPK and the glycolytic cascade, in SMAD4-deficient tumors as attractive strategies for therapeutic intervention.

Aberrant TGFbeta signaling pathway may alter the expression of down-stream targets and promotes ovarian carcinogenesis. However, the mechanism of this impairment is not fully understood. Our previous study has identified RunX1T1 as a putative SMAD4 target in an immortalized ovarian surface epithelial cell line, IOSE. In this study, we report that transcription of RunX1T1 was confirmed to be positively regulated by SMAD4 in IOSE cells and epigenetically silenced in a panel of ovarian cancer cell lines by promoter hypermethylation and histone methylation at H3 lysine 9. SMAD4 depletion increased repressive histone modifications of RunX1T1 promoter without affecting promoter methylation in IOSE cells. Epigenetic treatment can restore RunX1T1 expression by reversing its epigenetic status in MCP3 ovarian cancer cells. When transiently treated with a demethylating agent, the expression of RunX1T1 was partially restored in MCP3 cells, but gradual re-silencing through promoter re-methylation was observed after the treatment. Interestingly, SMAD4 knockdown accelerated this re-silencing process, suggesting that normal TGF-beta signaling is essential for the maintenance of RunX1T1 expression. In vivo analysis confirmed that hypermethylation of RunX1T1 was detected in 35.7% (34/95) of ovarian tumors with high clinical stages (P=0.035) and in 83% (5/6) of primary ovarian cancer-initiating cells. Additionally, concurrent methylation of RunX1T1 and another SMAD4 target, FBXO32 which was previously found to be hypermethylated in ovarian cancer was observed in this same sample cohort (P< 0.05). Restoration of RunX1T1 inhibited cancer cell growth. Taken together, dysregulated TGFbeta/SMAD4 signaling may lead to epigenetic silencing of a putative tumor suppressor, RunX1T1, during ovarian carcinogenesis.

Myhre syndrome is a developmental disorder characterized by reduced growth, generalized muscular hypertrophy, facial dysmorphism, deafness, cognitive deficits, joint stiffness, and skeletal anomalies. Here, by performing exome sequencing of a single affected individual and coupling the results to a hypothesis-driven filtering strategy, we establish that heterozygous mutations in SMAD4, which encodes for a transducer mediating transforming growth factor beta and bone morphogenetic protein signaling branches, underlie this rare Mendelian trait. Two recurrent de novo SMAD4 mutations were identified in eight unrelated subjects. Both mutations were missense changes altering Ile500 within the evolutionary conserved MAD homology 2 domain, a well known mutational hot spot in malignancies. Structural analyses suggest that the substituted residues are likely to perturb the binding properties of the mutant protein to signaling partners. Although SMAD4 has been established as a tumor suppressor gene somatically mutated in pancreatic, gastrointestinal, and skin cancers, and germline loss-of-function lesions and deletions of this gene have been documented to cause disorders that predispose individuals to gastrointestinal cancer and vascular dysplasias, the present report identifies a previously unrecognized class of mutations in the gene with profound impact on development and growth.

Self-aggregation of transforming growth factor beta (TGF-beta)1-induced antiapoptotic factor (TIAF1) is known in the nondemented human hippocampus, and the aggregating process may lead to generation of amyloid beta (Abeta) for causing neurodegeneration. Here, we determined that overexpressed TIAF1 exhibits as aggregates together with Smad4 and Abeta in the cancer stroma and peritumor capsules of solid tumors. Also, TIAF1/Abeta aggregates are shown on the interface between brain neural cells and the metastatic cancer cell mass. TIAF1 is upregulated in developing tumors, but may disappear in established metastatic cancer cells. Growing neuroblastoma cells on the extracellular matrices from other cancer cell types induced production of aggregated TIAF1 and Abeta. In vitro induction of TIAF1 self-association upregulated the expression of tumor suppressors Smad4 and WW domain-containing oxidoreductase (WOX1 or WWOX), and WOX1 in turn increased the TIAF1 expression. TIAF1/Smad4 interaction further enhanced Abeta formation. TIAF1 is known to suppress SMAD-regulated promoter activation. Intriguingly, without p53, self-aggregating TIAF1 spontaneously activated the SMAD-regulated promoter. TIAF1 was essential for p53-, WOX1- and dominant-negative JNK1-induced cell death. TIAF1, p53 and WOX1 acted synergistically in suppressing anchorage-independent growth, blocking cell migration and causing apoptosis. Together, TIAF1 shows an aggregation-dependent control of tumor progression and metastasis, and regulation of cell death.

About 90 percent of human pancreatic carcinomas show allelic loss at chromosome 18q. To identify candidate tumor suppressor genes on 18q, a panel of pancreatic carcinomas were analyzed for convergent sites of homozygous deletion. Twenty-five of 84 tumors had homozygous deletions at 18q21.1, a site that excludes DCC (a candidate suppressor gene for colorectal cancer) and includes DPC4, a gene similar in sequence to a Drosophila melanogaster gene (Mad) implicated in a transforming growth factor-beta (TGF-beta)-like signaling pathway. Potentially inactivating mutations in DPC4 were identified in six of 27 pancreatic carcinomas that did not have homozygous deletions at 18q21.1. These results identify DPC4 as a candidate tumor suppressor gene whose inactivation may play a role in pancreatic and possibly other human cancers.

Upon ligand binding, the receptors of the TGFbeta family phosphorylate Smad proteins, which then move into the nucleus where they activate transcription. To carry out this function, the receptor-activated Smads 1 and 2 require association with the product of deleted in pancreatic carcinoma, locus 4 (DPC4), Smad4. We investigated the step at which Smad4 is required for transcriptional activation. Smad4 is not required for nuclear translocation of Smads 1 or 2, or for association of Smad2 with a DNA binding partner, the winged helix protein FAST-1. Receptor-activated Smad2 takes Smad4 into the nucleus where they form a complex with FAST-1 that requires these three components to activate transcription. Smad4 contributes two functions: Through its amino-terminal domain, Smad4 promotes binding of the Smad2/Smad4/FAST-1 complex to DNA; through its carboxy-terminal domain, Smad4 provides an activation function required for Smad1 or Smad2 to stimulate transcription. The dual function of Smad4 in transcriptional activation underscores its central role in TGFbeta signaling.

mutations in the SMAD4/DPC4 tumor suppressor gene, a key signal transducer in most TGFbeta-related pathways, are involved in 50% of pancreatic cancers. Homozygous Smad4 mutant mice die before day 7.5 of embryogenesis. Mutant embryos have reduced size, fail to gastrulate or express a mesodermal marker, and show abnormal visceral endoderm development. Growth retardation of the Smad4-deficient embryos results from reduced cell proliferation rather than increased apoptosis. Aggregation of mutant Smad4 ES cells with wild-type tetraploid morulae rescues the gastrulation defect. These results indicate that Smad4 is initially required for the differentiation of the visceral endoderm and that the gastrulation defect in the epiblast is secondary and non-cell autonomous. Rescued embryos show severe anterior truncations, indicating a second important role for Smad4 in anterior patterning during embryogenesis.

Members of the transforming growth factor (TGF)-beta superfamily have been shown to play a variety of important roles in embryogenesis, including dorsal and ventral mesoderm induction. The tumor suppressor SMAD4, also known as DPC4, is believed to be an essential factor that mediates TGF-beta signals. To explore functions of SMAD4 in development, we have mutated it by truncating its functional C-domain. We show that Smad4 is expressed ubiquitously during murine embryogenesis. Mice heterozygous for the Smad4(ex8/+) mutation are developmentally normal, whereas homozygotes die between embryonic day 6.5 (E6.5) and 8.5. All Smad4(ex8/ex8) mutants are developmentally delayed at E6 and show little or no elongation in the extraembryonic portion of late egg cylinder stage embryos. Consistent with this, cultured Smad4(ex8/ex8) blastocyst outgrowths suffer cellular proliferation defects and fail to undergo endoderm differentiation. Although a portion of mutant embryos at E8.5 show an increase in the embryonic ectoderm and endoderm, morphological and molecular analyses indicate that they do not form mesoderm. Altogether, these data demonstrate that SMAD4-mediated signals are required for epiblast proliferation, egg cylinder formation, and mesoderm induction.