|
||
|
||
General information | Expression | Regulation | Mutation | Interaction |
Basic Information |
|
---|---|
Gene ID | 150094 |
Name | SIK1 |
Synonymous | MSK|SIK|SNF1LK;salt-inducible kinase 1;SIK1;salt-inducible kinase 1 |
Definition | SIK-1|SNF1-like kinase|myocardial SNF1-like kinase|salt-inducible protein kinase 1|serine/threonine protein kinase|serine/threonine-protein kinase SIK1|serine/threonine-protein kinase SNF1-like kinase 1|serine/threonine-protein kinase SNF1LK |
Position | 21q22.3 |
Gene Type | protein-coding |
Gene Mutation: | Substitution Insertion & Deletion Other Mutation |
Substitution | | Top | |
Mutation (Type; AA; Chr) |
Site |
Histology |
---|---|---|
Substitution - coding silent; c.204G>A; 21:43669784-43669784 |
testis | non_seminoma; germ_cell_tumour |
Substitution - coding silent; c.204G>A; 21:43669784-43669784 |
testis | non_seminoma; germ_cell_tumour |
Substitution - coding silent; c.723C>T; 21:43665343-43665343 |
ovary | serous_carcinoma; carcinoma |
Indel | | Top | |
Mutation (Type; AA; Chr) |
Site |
Histology |
---|---|---|
Deletion - Frameshift; c.2154_2176delGTCCCCGGTGGCCTCAGCGGCGC; 21:43661232-43661254 |
lung | non_small_cell_carcinoma; carcinoma |
Deletion - Frameshift; c.2154_2176delGTCCCCGGTGGCCTCAGCGGCGC; 21:43661232-43661254 |
lung | non_small_cell_carcinoma; carcinoma |
Other Mutation | | Top | |
There is no record for SIK1 |
Copyright © 2016-Present - The Univsersity of Texas Health Science Center at Houston Rights Reserved |