Gene Page: TRIM13
Summary ?
| GeneID | 10206 |
| Symbol | TRIM13 |
| Synonyms | CAR|DLEU5|LEU5|RFP2|RNF77 |
| Description | tripartite motif containing 13 |
| Reference | MIM:605661|HGNC:HGNC:9976|Ensembl:ENSG00000204977|HPRD:10414|Vega:OTTHUMG00000016926 |
| Gene type | protein-coding |
| Map location | 13q14 |
| Pascal p-value | 0.047 |
| Sherlock p-value | 0.668 |
| eGene | Myers' cis & trans |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS |
Section I. Genetics and epigenetics annotation
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs13005317 | chr2 | 34580511 | TRIM13 | 10206 | 0.11 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0004871 | signal transducer activity | IMP | 12761501 | |
| GO:0005515 | protein binding | IEA | - | |
| GO:0008270 | zinc ion binding | IEA | - | |
| GO:0046872 | metal ion binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0009653 | anatomical structure morphogenesis | TAS | 9599022 | |
| GO:0043123 | positive regulation of I-kappaB kinase/NF-kappaB cascade | IMP | 12761501 | |
| GO:0045786 | negative regulation of cell cycle | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005813 | centrosome | IDA | 18029348 | |
| GO:0005622 | intracellular | IEA | - | |
| GO:0005634 | nucleus | IDA | 18029348 | |
| GO:0005730 | nucleolus | IDA | 18029348 | |
| GO:0005737 | cytoplasm | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| HOLLMANN APOPTOSIS VIA CD40 DN | 267 | 178 | All SZGR 2.0 genes in this pathway |
| DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
| BASAKI YBX1 TARGETS DN | 384 | 230 | All SZGR 2.0 genes in this pathway |
| RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN | 805 | 505 | All SZGR 2.0 genes in this pathway |
| ENK UV RESPONSE KERATINOCYTE DN | 485 | 334 | All SZGR 2.0 genes in this pathway |
| WANG ESOPHAGUS CANCER VS NORMAL DN | 101 | 66 | All SZGR 2.0 genes in this pathway |
| DACOSTA UV RESPONSE VIA ERCC3 UP | 309 | 199 | All SZGR 2.0 genes in this pathway |
| SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN | 584 | 395 | All SZGR 2.0 genes in this pathway |
| NUYTTEN EZH2 TARGETS DN | 1024 | 594 | All SZGR 2.0 genes in this pathway |
| BUYTAERT PHOTODYNAMIC THERAPY STRESS UP | 811 | 508 | All SZGR 2.0 genes in this pathway |
| TCGA GLIOBLASTOMA COPY NUMBER DN | 31 | 21 | All SZGR 2.0 genes in this pathway |
| HASLINGER B CLL WITH 13Q14 DELETION | 24 | 18 | All SZGR 2.0 genes in this pathway |
| IVANOVA HEMATOPOIESIS EARLY PROGENITOR | 532 | 309 | All SZGR 2.0 genes in this pathway |
| ZHANG RESPONSE TO CANTHARIDIN UP | 19 | 12 | All SZGR 2.0 genes in this pathway |
| GENTILE UV HIGH DOSE DN | 312 | 203 | All SZGR 2.0 genes in this pathway |
| DAZARD RESPONSE TO UV NHEK DN | 318 | 220 | All SZGR 2.0 genes in this pathway |
| GENTILE RESPONSE CLUSTER D3 | 61 | 39 | All SZGR 2.0 genes in this pathway |
| OUILLETTE CLL 13Q14 DELETION DN | 60 | 38 | All SZGR 2.0 genes in this pathway |
| BOCHKIS FOXA2 TARGETS | 425 | 261 | All SZGR 2.0 genes in this pathway |
| HUANG DASATINIB RESISTANCE DN | 69 | 44 | All SZGR 2.0 genes in this pathway |
| MARTENS TRETINOIN RESPONSE DN | 841 | 431 | All SZGR 2.0 genes in this pathway |
| LU EZH2 TARGETS DN | 414 | 237 | All SZGR 2.0 genes in this pathway |
| PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
| JOHNSTONE PARVB TARGETS 3 DN | 918 | 550 | All SZGR 2.0 genes in this pathway |
| BRUINS UVC RESPONSE MIDDLE | 98 | 56 | All SZGR 2.0 genes in this pathway |
| ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-181 | 2330 | 2336 | m8 | hsa-miR-181abrain | AACAUUCAACGCUGUCGGUGAGU |
| hsa-miR-181bSZ | AACAUUCAUUGCUGUCGGUGGG | ||||
| hsa-miR-181cbrain | AACAUUCAACCUGUCGGUGAGU | ||||
| hsa-miR-181dbrain | AACAUUCAUUGUUGUCGGUGGGUU | ||||
| miR-335 | 2684 | 2690 | m8 | hsa-miR-335brain | UCAAGAGCAAUAACGAAAAAUGU |
| miR-376 | 2567 | 2574 | 1A,m8 | hsa-miR-376a | AUCAUAGAGGAAAAUCCACGU |
| hsa-miR-376b | AUCAUAGAGGAAAAUCCAUGUU | ||||
| miR-378 | 2312 | 2319 | 1A,m8 | hsa-miR-378 | CUCCUGACUCCAGGUCCUGUGU |
| miR-452 | 2124 | 2131 | 1A,m8 | hsa-miR-452 | UGUUUGCAGAGGAAACUGAGAC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.