Gene Page: TBR1
Summary ?
GeneID | 10716 |
Symbol | TBR1 |
Synonyms | TBR-1|TES-56 |
Description | T-box, brain 1 |
Reference | MIM:604616|HGNC:HGNC:11590|HPRD:07055| |
Gene type | protein-coding |
Map location | 2q24 |
Pascal p-value | 0.254 |
Fetal beta | 1.074 |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.02395 | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenics,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 2 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](/SZGR/GeneImg/TBR1_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
SNX3 | 0.61 | 0.63 |
GNG3 | 0.61 | 0.67 |
PTS | 0.60 | 0.68 |
PSMG1 | 0.59 | 0.66 |
XRCC6BP1 | 0.59 | 0.64 |
ATP6V0B | 0.59 | 0.61 |
METTL11A | 0.59 | 0.62 |
PNOC | 0.59 | 0.71 |
NGB | 0.58 | 0.58 |
TPI1 | 0.58 | 0.62 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
TENC1 | -0.38 | -0.43 |
SLC27A1 | -0.35 | -0.38 |
PHLDB1 | -0.33 | -0.30 |
GP1BA | -0.32 | -0.36 |
AC010618.2 | -0.32 | -0.36 |
FAM38A | -0.32 | -0.34 |
RAPGEF3 | -0.31 | -0.35 |
MTSS1L | -0.31 | -0.38 |
HIP1R | -0.31 | -0.28 |
PSD2 | -0.30 | -0.31 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003700 | transcription factor activity | TAS | 7619531 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007411 | axon guidance | IEA | axon (GO term level: 13) | - |
GO:0030902 | hindbrain development | IEA | Brain (GO term level: 8) | - |
GO:0006355 | regulation of transcription, DNA-dependent | IEA | - | |
GO:0045944 | positive regulation of transcription from RNA polymerase II promoter | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
MARTORIATI MDM4 TARGETS NEUROEPITHELIUM DN | 164 | 111 | All SZGR 2.0 genes in this pathway |
BENPORATH SUZ12 TARGETS | 1038 | 678 | All SZGR 2.0 genes in this pathway |
BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
BENPORATH PRC2 TARGETS | 652 | 441 | All SZGR 2.0 genes in this pathway |
MCCLUNG COCAINE REWARD 5D | 79 | 62 | All SZGR 2.0 genes in this pathway |
KAYO AGING MUSCLE UP | 244 | 165 | All SZGR 2.0 genes in this pathway |
MCCLUNG DELTA FOSB TARGETS 2WK | 48 | 36 | All SZGR 2.0 genes in this pathway |
MCCLUNG CREB1 TARGETS UP | 100 | 72 | All SZGR 2.0 genes in this pathway |
BACOLOD RESISTANCE TO ALKYLATING AGENTS DN | 60 | 45 | All SZGR 2.0 genes in this pathway |
YAUCH HEDGEHOG SIGNALING PARACRINE DN | 264 | 159 | All SZGR 2.0 genes in this pathway |
HOFMANN MYELODYSPLASTIC SYNDROM LOW RISK UP | 22 | 15 | All SZGR 2.0 genes in this pathway |
MEISSNER NPC HCP WITH H3 UNMETHYLATED | 536 | 296 | All SZGR 2.0 genes in this pathway |
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 | 1069 | 729 | All SZGR 2.0 genes in this pathway |
YAGI AML WITH INV 16 TRANSLOCATION | 422 | 277 | All SZGR 2.0 genes in this pathway |
WONG ADULT TISSUE STEM MODULE | 721 | 492 | All SZGR 2.0 genes in this pathway |
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY | 1725 | 838 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-141/200a | 542 | 548 | 1A | hsa-miR-141 | UAACACUGUCUGGUAAAGAUGG |
hsa-miR-200a | UAACACUGUCUGGUAACGAUGU | ||||
miR-27 | 523 | 529 | 1A | hsa-miR-27abrain | UUCACAGUGGCUAAGUUCCGC |
hsa-miR-27bbrain | UUCACAGUGGCUAAGUUCUGC | ||||
miR-375 | 514 | 520 | 1A | hsa-miR-375 | UUUGUUCGUUCGGCUCGCGUGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.