Gene Page: PPARGC1B
Summary ?
GeneID | 133522 |
Symbol | PPARGC1B |
Synonyms | ERRL1|PERC|PGC-1(beta)|PGC1B |
Description | PPARG coactivator 1 beta |
Reference | MIM:608886|HGNC:HGNC:30022|Ensembl:ENSG00000155846|HPRD:10594|Vega:OTTHUMG00000130055 |
Gene type | protein-coding |
Map location | 5q32 |
Pascal p-value | 0.009 |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
GSMA_I | Genome scan meta-analysis | Psr: 0.0032 | |
GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00459 | |
GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.01718 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0000166 | nucleotide binding | IEA | - | |
GO:0003676 | nucleic acid binding | IEA | - | |
GO:0003723 | RNA binding | NAS | 11854298 | |
GO:0016455 | RNA polymerase II transcription mediator activity | IDA | 11854298 | |
GO:0030546 | receptor activator activity | IDA | 11854298 | |
GO:0030331 | estrogen receptor binding | IDA | 11854298 | |
GO:0030374 | ligand-dependent nuclear receptor transcription coactivator activity | IDA | 11854298 | |
GO:0030374 | ligand-dependent nuclear receptor transcription coactivator activity | ISS | - | |
GO:0050682 | AF-2 domain binding | IPI | 11854298 | |
GO:0050682 | AF-2 domain binding | ISS | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006355 | regulation of transcription, DNA-dependent | IEA | - | |
GO:0030520 | estrogen receptor signaling pathway | IDA | 11854298 | |
GO:0030520 | estrogen receptor signaling pathway | ISS | - | |
GO:0006350 | transcription | IEA | - | |
GO:0045944 | positive regulation of transcription from RNA polymerase II promoter | IDA | 11854298 | |
GO:0045944 | positive regulation of transcription from RNA polymerase II promoter | ISS | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0000119 | mediator complex | IDA | 11854298 | |
GO:0005634 | nucleus | IDA | 11854298 | |
GO:0005634 | nucleus | ISS | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
REACTOME PPARA ACTIVATES GENE EXPRESSION | 104 | 72 | All SZGR 2.0 genes in this pathway |
REACTOME METABOLISM OF LIPIDS AND LIPOPROTEINS | 478 | 302 | All SZGR 2.0 genes in this pathway |
REACTOME FATTY ACID TRIACYLGLYCEROL AND KETONE BODY METABOLISM | 168 | 115 | All SZGR 2.0 genes in this pathway |
SENESE HDAC1 AND HDAC2 TARGETS UP | 238 | 144 | All SZGR 2.0 genes in this pathway |
KINSEY TARGETS OF EWSR1 FLII FUSION UP | 1278 | 748 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
MCBRYAN PUBERTAL BREAST 4 5WK DN | 196 | 131 | All SZGR 2.0 genes in this pathway |
GROSS HYPOXIA VIA ELK3 UP | 209 | 139 | All SZGR 2.0 genes in this pathway |
GROSS HYPOXIA VIA ELK3 ONLY DN | 44 | 30 | All SZGR 2.0 genes in this pathway |
ZHAN MULTIPLE MYELOMA CD1 AND CD2 DN | 51 | 32 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 6HR DN | 911 | 527 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 24HR DN | 1011 | 592 | All SZGR 2.0 genes in this pathway |
TOYOTA TARGETS OF MIR34B AND MIR34C | 463 | 262 | All SZGR 2.0 genes in this pathway |
JIANG TIP30 TARGETS UP | 46 | 28 | All SZGR 2.0 genes in this pathway |
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 | 1069 | 729 | All SZGR 2.0 genes in this pathway |
LI INDUCED T TO NATURAL KILLER DN | 116 | 83 | All SZGR 2.0 genes in this pathway |
WANG CLASSIC ADIPOGENIC TARGETS OF PPARG | 26 | 15 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
BHAT ESR1 TARGETS NOT VIA AKT1 UP | 211 | 131 | All SZGR 2.0 genes in this pathway |
BHAT ESR1 TARGETS VIA AKT1 UP | 281 | 183 | All SZGR 2.0 genes in this pathway |
GOBERT OLIGODENDROCYTE DIFFERENTIATION UP | 570 | 339 | All SZGR 2.0 genes in this pathway |
GUO TARGETS OF IRS1 AND IRS2 | 98 | 67 | All SZGR 2.0 genes in this pathway |
RATTENBACHER BOUND BY CELF1 | 467 | 251 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
let-7/98 | 32 | 38 | 1A | hsa-let-7abrain | UGAGGUAGUAGGUUGUAUAGUU |
hsa-let-7bbrain | UGAGGUAGUAGGUUGUGUGGUU | ||||
hsa-let-7cbrain | UGAGGUAGUAGGUUGUAUGGUU | ||||
hsa-let-7dbrain | AGAGGUAGUAGGUUGCAUAGU | ||||
hsa-let-7ebrain | UGAGGUAGGAGGUUGUAUAGU | ||||
hsa-let-7fbrain | UGAGGUAGUAGAUUGUAUAGUU | ||||
hsa-miR-98brain | UGAGGUAGUAAGUUGUAUUGUU | ||||
hsa-let-7gSZ | UGAGGUAGUAGUUUGUACAGU | ||||
hsa-let-7ibrain | UGAGGUAGUAGUUUGUGCUGU | ||||
hsa-let-7abrain | UGAGGUAGUAGGUUGUAUAGUU | ||||
hsa-let-7bbrain | UGAGGUAGUAGGUUGUGUGGUU | ||||
hsa-let-7cbrain | UGAGGUAGUAGGUUGUAUGGUU | ||||
hsa-let-7dbrain | AGAGGUAGUAGGUUGCAUAGU | ||||
hsa-let-7ebrain | UGAGGUAGGAGGUUGUAUAGU | ||||
hsa-let-7fbrain | UGAGGUAGUAGAUUGUAUAGUU | ||||
hsa-miR-98brain | UGAGGUAGUAAGUUGUAUUGUU | ||||
hsa-let-7gSZ | UGAGGUAGUAGUUUGUACAGU | ||||
hsa-let-7ibrain | UGAGGUAGUAGUUUGUGCUGU | ||||
miR-124.1 | 6 | 12 | 1A | hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA |
miR-26 | 127 | 133 | 1A | hsa-miR-26abrain | UUCAAGUAAUCCAGGAUAGGC |
hsa-miR-26bSZ | UUCAAGUAAUUCAGGAUAGGUU | ||||
miR-30-5p | 57 | 63 | m8 | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.