Gene Page: ADAMTS19
Summary ?
| GeneID | 171019 |
| Symbol | ADAMTS19 |
| Synonyms | - |
| Description | ADAM metallopeptidase with thrombospondin type 1 motif 19 |
| Reference | MIM:607513|HGNC:HGNC:17111|Ensembl:ENSG00000145808|HPRD:06334|Vega:OTTHUMG00000128990 |
| Gene type | protein-coding |
| Map location | 5q23.3 |
| Pascal p-value | 0.015 |
| Fetal beta | -1.875 |
| DMG | 1 (# studies) |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Nishioka_2013 | Genome-wide DNA methylation analysis | The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls. | 1 |
| GSMA_I | Genome scan meta-analysis | Psr: 0.0032 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg15034135 | 5 | 128796168 | ADAMTS19 | -0.027 | 0.27 | DMG:Nishioka_2013 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0004222 | metalloendopeptidase activity | IEA | - | |
| GO:0008270 | zinc ion binding | IEA | - | |
| GO:0008233 | peptidase activity | IEA | - | |
| GO:0046872 | metal ion binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006508 | proteolysis | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005576 | extracellular region | IEA | - | |
| GO:0005578 | proteinaceous extracellular matrix | IEA | - | |
| GO:0005622 | intracellular | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| GOZGIT ESR1 TARGETS DN | 781 | 465 | All SZGR 2.0 genes in this pathway |
| SCHAEFFER PROSTATE DEVELOPMENT 48HR DN | 428 | 306 | All SZGR 2.0 genes in this pathway |
| CREIGHTON ENDOCRINE THERAPY RESISTANCE 1 | 528 | 324 | All SZGR 2.0 genes in this pathway |
| CREIGHTON ENDOCRINE THERAPY RESISTANCE 4 | 307 | 185 | All SZGR 2.0 genes in this pathway |
| MASSARWEH TAMOXIFEN RESISTANCE DN | 258 | 160 | All SZGR 2.0 genes in this pathway |
| MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 | 1069 | 729 | All SZGR 2.0 genes in this pathway |
| ROME INSULIN TARGETS IN MUSCLE DN | 204 | 114 | All SZGR 2.0 genes in this pathway |
| MEISSNER NPC HCP WITH H3K4ME2 | 491 | 319 | All SZGR 2.0 genes in this pathway |
| NABA ECM REGULATORS | 238 | 125 | All SZGR 2.0 genes in this pathway |
| NABA MATRISOME ASSOCIATED | 753 | 411 | All SZGR 2.0 genes in this pathway |
| NABA MATRISOME | 1028 | 559 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-181 | 507 | 513 | 1A | hsa-miR-181abrain | AACAUUCAACGCUGUCGGUGAGU |
| hsa-miR-181bSZ | AACAUUCAUUGCUGUCGGUGGG | ||||
| hsa-miR-181cbrain | AACAUUCAACCUGUCGGUGAGU | ||||
| hsa-miR-181dbrain | AACAUUCAUUGUUGUCGGUGGGUU | ||||
| miR-185 | 323 | 329 | m8 | hsa-miR-185brain | UGGAGAGAAAGGCAGUUC |
| miR-26 | 633 | 640 | 1A,m8 | hsa-miR-26abrain | UUCAAGUAAUCCAGGAUAGGC |
| hsa-miR-26bSZ | UUCAAGUAAUUCAGGAUAGGUU | ||||
| miR-29 | 315 | 321 | 1A | hsa-miR-29aSZ | UAGCACCAUCUGAAAUCGGUU |
| hsa-miR-29bSZ | UAGCACCAUUUGAAAUCAGUGUU | ||||
| hsa-miR-29cSZ | UAGCACCAUUUGAAAUCGGU | ||||
| miR-369-3p | 751 | 757 | m8 | hsa-miR-369-3p | AAUAAUACAUGGUUGAUCUUU |
| miR-544 | 427 | 433 | m8 | hsa-miR-544 | AUUCUGCAUUUUUAGCAAGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.