Gene Page: DRD2

Summary ?
GeneID1813
SymbolDRD2
SynonymsD2DR|D2R
Descriptiondopamine receptor D2
ReferenceMIM:126450|HGNC:HGNC:3023|Ensembl:ENSG00000149295|HPRD:00539|Vega:OTTHUMG00000167717
Gene typeprotein-coding
Map location11q23
Pascal p-value1.601E-7
Fetal beta-0.638
eGeneMyers' cis & trans
SupportGPCR SIGNALLING
Potential synaptic genes

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
ADT:Sun_2012Systematic Investigation of Antipsychotic Drugs and Their TargetsA total of 382 drug-target associations involving 43 antipsychotic drugs and 49 target genes.
CV:GWAScatGenome-wide Association StudiesThis data set includes 560 SNPs associated with schizophrenia. A total of 486 genes were mapped to these SNPs within 50kb.
CV:GWASdbGenome-wide Association StudiesGWASdb records for schizophrenia
CV:PGC128Genome-wide Association StudyA multi-stage schizophrenia GWAS of up to 36,989 cases and 113,075 controls. Reported by the Schizophrenia Working Group of PGC. 128 independent associations spanning 108 loci
CV:PGCnpGenome-wide Association StudyGWAS
PMID:cooccurHigh-throughput literature-searchSystematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
AssociationA combined odds ratio method (Sun et al. 2008), association studies3Link to SZGene
GSMA_IGenome scan meta-analysisPsr: 0.006 
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenics,schizotypy,schizophrenias,schizotypalClick to show details
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 16 
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 31 

Section I. Genetics and epigenetics annotation

@CV:PGC128

SNP IDChromosomePositionAllelePFunctionGeneUp/Down Distance
rs2514218chr11113392994TC4.091E-10intergenicDRD2,TMPRSS5dist=46993;dist=165274

@eQTL annotation

SNP IDChromosomePositioneGeneGene Entrez IDpvalueqvalueTSS distanceeQTL type
rs2190759chr1755794698DRD218130.08trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions


Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0004952dopamine receptor activityIEANeurotransmitter, dopamine (GO term level: 8)-
GO:0001670dopamine D2 receptor activityIDAdopamine (GO term level: 10)8301582 
GO:0004872receptor activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0048755branching morphogenesis of a nerveISSneuron (GO term level: 6)-
GO:0007416synaptogenesisISSSynap (GO term level: 6)-
GO:0007409axonogenesisISSneuron, axon, neurite (GO term level: 12)-
GO:0060160negative regulation of dopamine receptor signaling pathwayISSdopamine (GO term level: 10)-
GO:0060158dopamine receptor, phospholipase C activating pathwayIGIdopamine (GO term level: 10)17194762 
GO:0051586positive regulation of dopamine uptakeISSdopamine (GO term level: 12)-
GO:0051967negative regulation of synaptic transmission, glutamatergicISSneuron, glutamate, Synap, Neurotransmitter (GO term level: 10)-
GO:0007270nerve-nerve synaptic transmissionISSneuron, Synap (GO term level: 7)-
GO:0048169regulation of long-term neuronal synaptic plasticityISSneuron, Synap (GO term level: 10)-
GO:0032228regulation of synaptic transmission, GABAergicISSneuron, GABA, Synap, Neurotransmitter (GO term level: 9)-
GO:0021853cerebral cortex GABAergic interneuron migrationISSneuron, GABA (GO term level: 14)-
GO:0042417dopamine metabolic processICNeurotransmitter, dopamine (GO term level: 8)8301582 
GO:0001659temperature homeostasisISS-
GO:0002052positive regulation of neuroblast proliferationISS-
GO:0002027regulation of heart rateISS-
GO:0002028regulation of sodium ion transportISS-
GO:0001975response to amphetamineISS-
GO:0001976regulation of systemic arterial blood pressure by neurological processISS-
GO:0007186G-protein coupled receptor protein signaling pathwayIEA-
GO:0007165signal transductionIEA-
GO:0008285negative regulation of cell proliferationISS-
GO:0008306associative learningISS-
GO:0008542visual learningISS-
GO:0009416response to light stimulusISS-
GO:0007628adult walking behaviorISS-
GO:0007626locomotory behaviorISS-
GO:0008104protein localizationISS-
GO:0007608sensory perception of smellISS-
GO:0042493response to drugISS-
GO:0021984adenohypophysis developmentISS-
GO:0030432peristalsisISS-
GO:0051209release of sequestered calcium ion into cytosolISS-
GO:0030814regulation of cAMP metabolic processIDA8666994 
GO:0030146diuresisISS-
GO:0030147natriuresisISS-
GO:0032922circadian regulation of gene expressionISS-
GO:0030384phosphoinositide metabolic processISS-
GO:0030336negative regulation of cell migrationISS-
GO:0043278response to morphineISS-
GO:0043266regulation of potassium ion transportISS-
GO:0048148behavioral response to cocaineISS-
GO:0048149behavioral response to ethanolISS-
GO:0050709negative regulation of protein secretionIDA16839358 
GO:0050482arachidonic acid secretionIDA8301582 
GO:0060124positive regulation of growth hormone secretionISS-
GO:0045776negative regulation of blood pressureISS-
GO:0051898negative regulation of protein kinase B signaling cascadeISS-
GO:0060134prepulse inhibitionISS-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0030425dendriteISSneuron, axon, dendrite (GO term level: 6)-
GO:0030424axonISSneuron, axon, Neurotransmitter (GO term level: 6)-
GO:0016021integral to membraneIEA-
GO:0005886plasma membraneIEA-

Section IV. Protein-protein interaction annotation

InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ADORA2AADORA2 | RDC8 | hA2aRadenosine A2a receptor-HPRD,BioGRID12804599 
CLIC6CLIC1Lchloride intracellular channel 6-HPRD,BioGRID14499480 
DRD2D2DR | D2Rdopamine receptor D2D2S receptors form homodimers through Cys126 in the fourth transmembrane segment.BIND12496294 
EPB414.1R | EL1 | HEerythrocyte membrane protein band 4.1 (elliptocytosis 1, RH-linked)-HPRD12181426 
EPB41L14.1N | DKFZp686H17242 | KIAA0338 | MGC11072erythrocyte membrane protein band 4.1-like 1-HPRD,BioGRID12181426 
FLNAABP-280 | ABPX | DKFZp434P031 | FLN | FLN1 | FMD | MNS | NHBP | OPD | OPD1 | OPD2filamin A, alpha (actin binding protein 280)Affinity Capture-WesternBioGRID12181426 
FLNAABP-280 | ABPX | DKFZp434P031 | FLN | FLN1 | FMD | MNS | NHBP | OPD | OPD1 | OPD2filamin A, alpha (actin binding protein 280)Dopamine receptor D2 interacts with filamin A. This interaction was modeled on a demonstrated interaction between human FLN-A and D2 from unspecified source.BIND11320256 
FLNAABP-280 | ABPX | DKFZp434P031 | FLN | FLN1 | FMD | MNS | NHBP | OPD | OPD1 | OPD2filamin A, alpha (actin binding protein 280)-HPRD11911837 
FREQDKFZp761L1223 | FLUP | NCS-1 | NCS1frequenin homolog (Drosophila)-HPRD,BioGRID12351722 
FREQDKFZp761L1223 | FLUP | NCS-1 | NCS1frequenin homolog (Drosophila)The D2 dopamine receptor interacts with NCS-1.BIND12351722 
GNAI2GIP | GNAI2B | H_LUCA15.1 | H_LUCA16.1guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2-HPRD10978845 
GNAI387U6 | FLJ26559guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3-HPRD10978845 
GNAZ-guanine nucleotide binding protein (G protein), alpha z polypeptide-HPRD9166747 
KCNJ3GIRK1 | KGA | KIR3.1potassium inwardly-rectifying channel, subfamily J, member 3Affinity Capture-WesternBioGRID12297500 
KCNJ5CIR | GIRK4 | KATP1 | KIR3.4potassium inwardly-rectifying channel, subfamily J, member 5Affinity Capture-WesternBioGRID12297500 
KCNJ6BIR1 | GIRK2 | KATP2 | KCNJ7 | KIR3.2 | MGC126596 | hiGIRK2potassium inwardly-rectifying channel, subfamily J, member 6-HPRD,BioGRID12297500 
KCNJ9GIRK3 | KIR3.3potassium inwardly-rectifying channel, subfamily J, member 9-HPRD12297500 
PPP1R9BFLJ30345 | PPP1R6 | PPP1R9 | SPINO | Spnprotein phosphatase 1, regulatory (inhibitor) subunit 9B-HPRD,BioGRID10391935 
SSTR5-somatostatin receptor 5-HPRD10753124 


Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
KEGG NEUROACTIVE LIGAND RECEPTOR INTERACTION 272195All SZGR 2.0 genes in this pathway
KEGG GAP JUNCTION 9068All SZGR 2.0 genes in this pathway
BIOCARTA CK1 PATHWAY 1717All SZGR 2.0 genes in this pathway
ST G ALPHA I PATHWAY 3529All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY GPCR 920449All SZGR 2.0 genes in this pathway
REACTOME CLASS A1 RHODOPSIN LIKE RECEPTORS 305177All SZGR 2.0 genes in this pathway
REACTOME AMINE LIGAND BINDING RECEPTORS 3833All SZGR 2.0 genes in this pathway
REACTOME GPCR DOWNSTREAM SIGNALING 805368All SZGR 2.0 genes in this pathway
REACTOME G ALPHA I SIGNALLING EVENTS 195114All SZGR 2.0 genes in this pathway
REACTOME GPCR LIGAND BINDING 408246All SZGR 2.0 genes in this pathway
PARENT MTOR SIGNALING UP 567375All SZGR 2.0 genes in this pathway
DEURIG T CELL PROLYMPHOCYTIC LEUKEMIA UP 368234All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA UP 1821933All SZGR 2.0 genes in this pathway
GAUSSMANN MLL AF4 FUSION TARGETS D UP 3823All SZGR 2.0 genes in this pathway
XU HGF TARGETS REPRESSED BY AKT1 DN 9558All SZGR 2.0 genes in this pathway
MOHANKUMAR TLX1 TARGETS DN 193112All SZGR 2.0 genes in this pathway
GRUETZMANN PANCREATIC CANCER DN 203134All SZGR 2.0 genes in this pathway
JAZAG TGFB1 SIGNALING VIA SMAD4 DN 6638All SZGR 2.0 genes in this pathway
KIM MYCN AMPLIFICATION TARGETS UP 9264All SZGR 2.0 genes in this pathway
SHEN SMARCA2 TARGETS DN 357212All SZGR 2.0 genes in this pathway
LEE CALORIE RESTRICTION NEOCORTEX UP 8366All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP 16911088All SZGR 2.0 genes in this pathway
KAYO CALORIE RESTRICTION MUSCLE UP 9564All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP 1305895All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K27ME3 7959All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 1069729All SZGR 2.0 genes in this pathway
MIKKELSEN NPC HCP WITH H3K27ME3 341243All SZGR 2.0 genes in this pathway
MIKKELSEN MEF HCP WITH H3K27ME3 590403All SZGR 2.0 genes in this pathway
MARTENS TRETINOIN RESPONSE UP 857456All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-141/200a128134m8hsa-miR-141UAACACUGUCUGGUAAAGAUGG
hsa-miR-200aUAACACUGUCUGGUAACGAUGU
miR-2149789841Ahsa-miR-214brainACAGCAGGCACAGACAGGCAG
miR-3265275341A,m8hsa-miR-326CCUCUGGGCCCUUCCUCCAG
miR-92892961A,m8hsa-miR-9SZUCUUUGGUUAUCUAGCUGUAUGA