SZGR2

Summary ?

GeneID	1844
Symbol	DUSP2
Synonyms	PAC-1\|PAC1
Description	dual specificity phosphatase 2
Reference	MIM:603068\|HGNC:HGNC:3068\|Ensembl:ENSG00000158050\|HPRD:04348\|Vega:OTTHUMG00000130456
Gene type	protein-coding
Map location	2q11
Pascal p-value	0.002
Fetal beta	-1.465
eGene	Caudate basal ganglia Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
GSMA_I	Genome scan meta-analysis	Psr: 0.0004
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details

Section I. Genetics and epigenetics annotation

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	qvalue	eQTL type
rs725667	chr1	68488649	DUSP2	1844	0.14	trans
rs11807500	chr1	68503525	DUSP2	1844	0.01	trans
rs11808365	chr1	68507122	DUSP2	1844	0.14	trans
rs12086539	chr1	68507537	DUSP2	1844	0.13	trans
rs2566762	chr1	68582456	DUSP2	1844	0.13	trans
rs17100274	chr1	77774412	DUSP2	1844	0.18	trans
rs6666937	chr1	170286842	DUSP2	1844	0.13	trans
rs16843112	chr1	198420657	DUSP2	1844	0.01	trans
rs16843346	chr1	198543026	DUSP2	1844	0.08	trans
rs16843424	chr1	198572758	DUSP2	1844	0.1	trans
rs16843670	chr1	198650005	DUSP2	1844	0.01	trans
rs10925947	chr1	235701552	DUSP2	1844	0.06	trans
rs636167	chr1	237402264	DUSP2	1844	0	trans
rs652792	chr1	237403609	DUSP2	1844	0.04	trans
rs17490288	chr2	36902427	DUSP2	1844	0.1	trans
rs12465555	chr2	44118188	DUSP2	1844	0.07	trans
rs17024035	chr2	100968559	DUSP2	1844	0.18	trans
rs7574684	chr2	100992911	DUSP2	1844	0.18	trans
rs17024129	chr2	100995144	DUSP2	1844	0.18	trans
rs7585898	chr2	100998292	DUSP2	1844	0.18	trans
rs1370627	chr2	101009384	DUSP2	1844	0.18	trans
rs2014805	chr2	175165192	DUSP2	1844	0.01	trans
rs9807949	chr2	182655005	DUSP2	1844	0.07	trans
rs7608942	chr2	182820100	DUSP2	1844	4.193E-4	trans
rs4674479	chr2	220806451	DUSP2	1844	0.01	trans
rs1014141	chr3	43810759	DUSP2	1844	0.03	trans
rs7615639	chr3	43852564	DUSP2	1844	0.01	trans
rs9809244	chr3	62078922	DUSP2	1844	0	trans
rs17044826	chr3	66620522	DUSP2	1844	0.05	trans
rs7637903	chr3	103712766	DUSP2	1844	0.14	trans
rs6807632	chr3	111395567	DUSP2	1844	0.05	trans
rs728681	chr4	180794245	DUSP2	1844	0.17	trans
rs173177	chr5	16161616	DUSP2	1844	0.15	trans
rs1478417	chr5	122277035	DUSP2	1844	0.08	trans
rs1977059	chr6	5720825	DUSP2	1844	0.15	trans
rs6457967	chr6	37002011	DUSP2	1844	0.01	trans
rs10947885	chr6	40394397	DUSP2	1844	0.12	trans
rs9450829	chr6	88624436	DUSP2	1844	0.12	trans
rs6935871	chr6	109107049	DUSP2	1844	0.02	trans
rs12164028	chr6	136929934	DUSP2	1844	0.06	trans
rs887719	chr7	21184272	DUSP2	1844	0.01	trans
rs320082	chr7	29105404	DUSP2	1844	6.512E-8	trans
rs317720	chr7	29110633	DUSP2	1844	5.309E-7	trans
rs317714	chr7	29115553	DUSP2	1844	2.201E-7	trans
rs317724	chr7	29120565	DUSP2	1844	5.309E-7	trans
rs17141666	chr7	69928490	DUSP2	1844	0.13	trans
rs12540961	chr8	9689750	DUSP2	1844	0.11	trans
rs7829733	chr8	9691720	DUSP2	1844	5.234E-4	trans
rs4242415	chr8	24597175	DUSP2	1844	0.15	trans
rs16886605	chr8	115894398	DUSP2	1844	0.04	trans
rs799881	chr8	117260630	DUSP2	1844	0.09	trans
rs7850851	chr9	37928770	DUSP2	1844	0.18	trans
rs10121216	chr9	122379089	DUSP2	1844	0.18	trans
rs10985822	chr9	125685653	DUSP2	1844	0.05	trans
rs7024546	chr9	125696945	DUSP2	1844	0.04	trans
rs10985900	chr9	125954348	DUSP2	1844	0.11	trans
rs2417062	chr9	130715921	DUSP2	1844	0.02	trans
rs12569493	chr10	74886042	DUSP2	1844	0.1	trans
rs7092445	chr10	74921991	DUSP2	1844	0.15	trans
rs11000579	chr10	75027961	DUSP2	1844	0.04	trans
rs11000607	chr10	75089777	DUSP2	1844	0.19	trans
rs11203077	chr10	91097084	DUSP2	1844	2.026E-5	trans
rs10834670	chr11	25404015	DUSP2	1844	0.14	trans
rs2509929	chr11	58407072	DUSP2	1844	0.07	trans
rs2186571	chr11	63915699	DUSP2	1844	0.16	trans
rs1544538	chr11	63988339	DUSP2	1844	0.16	trans
rs10791832	chr11	65683917	DUSP2	1844	0.08	trans
rs11052230	chr12	32931283	DUSP2	1844	0.02	trans
rs11176643	chr12	67629785	DUSP2	1844	8.382E-4	trans
rs17113079	chr12	74538548	DUSP2	1844	0.13	trans
rs17113131	chr12	74564573	DUSP2	1844	0.13	trans
rs17764482	chr12	82483756	DUSP2	1844	0.14	trans
rs17026331	chr12	97478907	DUSP2	1844	0.12	trans
rs11066476	chr12	113465366	DUSP2	1844	1.066E-4	trans
rs4497566	chr13	51694324	DUSP2	1844	7.022E-5	trans
rs7322001	chr13	94895345	DUSP2	1844	0.03	trans
snp_a-1952108		0	DUSP2	1844	0.1	trans
rs2993290	chr13	113647189	DUSP2	1844	0.15	trans
rs17793815	chr14	22794531	DUSP2	1844	0.07	trans
rs10145685	chr14	22794892	DUSP2	1844	0.18	trans
rs17793827	chr14	22797560	DUSP2	1844	0.09	trans
rs10136383	chr14	22801078	DUSP2	1844	0.09	trans
rs11158850	chr14	70757171	DUSP2	1844	0.02	trans
rs2444983	chr15	33443919	DUSP2	1844	4.942E-4	trans
rs2412599	chr15	41347970	DUSP2	1844	0.08	trans
rs11072201	chr15	70857175	DUSP2	1844	0	trans
rs17781350	chr15	71108134	DUSP2	1844	0.12	trans
rs9302779	chr16	3933344	DUSP2	1844	0.17	trans
rs7200513	chr16	17219474	DUSP2	1844	0	trans
rs3829495	chr16	17221986	DUSP2	1844	5.104E-5	trans
rs16949485	chr16	79104374	DUSP2	1844	0.13	trans
rs2874668	chr17	11631907	DUSP2	1844	0.07	trans
rs16940752	chr17	11642174	DUSP2	1844	0.07	trans
rs12452652	chr17	72235560	DUSP2	1844	1.586E-9	trans
rs17188689	chr18	23359136	DUSP2	1844	0.18	trans
rs17056775	chr18	72988809	DUSP2	1844	0.16	trans
rs1523533	chr20	51329866	DUSP2	1844	0.01	trans
rs2689370	chr20	51335422	DUSP2	1844	0.07	trans
rs2745070	chr20	51337694	DUSP2	1844	0.07	trans
rs5992705	chr22	17914003	DUSP2	1844	0.03	trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
UNK	0.95	0.95
LIG1	0.95	0.90
CPSF1	0.94	0.94
HAUS5	0.94	0.93
MCM7	0.93	0.86
CD276	0.93	0.91
PLXNB2	0.93	0.91
RCC1	0.93	0.83
TCF3	0.93	0.90
AAAS	0.93	0.91

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
C5orf53	-0.67	-0.77
AF347015.31	-0.66	-0.85
AF347015.27	-0.65	-0.83
MT-CO2	-0.64	-0.84
AF347015.33	-0.62	-0.79
MT-CYB	-0.62	-0.81
AIFM3	-0.61	-0.66
S100B	-0.61	-0.73
AF347015.8	-0.61	-0.82
IFI27	-0.60	-0.75

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0004725	protein tyrosine phosphatase activity	TAS		7681221
GO:0016787	hydrolase activity	IEA		-
GO:0008330	protein tyrosine/threonine phosphatase activity	TAS		8107850
GO:0017017	MAP kinase tyrosine/serine/threonine phosphatase activity	IEA		-
GO:0051019	mitogen-activated protein kinase binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000188	inactivation of MAPK activity	TAS		8107850
GO:0006470	protein amino acid dephosphorylation	IEA		-
GO:0006470	protein amino acid dephosphorylation	TAS		8107850
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	TAS		8107850

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG MAPK SIGNALING PATHWAY	267	205	All SZGR 2.0 genes in this pathway
PICCALUGA ANGIOIMMUNOBLASTIC LYMPHOMA DN	136	86	All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE LIVE UP	485	293	All SZGR 2.0 genes in this pathway
OSWALD HEMATOPOIETIC STEM CELL IN COLLAGEN GEL UP	233	161	All SZGR 2.0 genes in this pathway
NAGASHIMA NRG1 SIGNALING UP	176	123	All SZGR 2.0 genes in this pathway
NAGASHIMA EGF SIGNALING UP	58	40	All SZGR 2.0 genes in this pathway
HAHTOLA SEZARY SYNDROM DN	42	26	All SZGR 2.0 genes in this pathway
ENK UV RESPONSE EPIDERMIS DN	508	354	All SZGR 2.0 genes in this pathway
WANG ESOPHAGUS CANCER VS NORMAL UP	121	72	All SZGR 2.0 genes in this pathway
WANG ESOPHAGUS CANCER PROGRESSION UP	9	6	All SZGR 2.0 genes in this pathway
DIRMEIER LMP1 RESPONSE EARLY	66	48	All SZGR 2.0 genes in this pathway
WATTEL AUTONOMOUS THYROID ADENOMA DN	55	29	All SZGR 2.0 genes in this pathway
GROSS HYPOXIA VIA ELK3 DN	156	106	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 48HR DN	428	306	All SZGR 2.0 genes in this pathway
AMIT EGF RESPONSE 40 HELA	42	29	All SZGR 2.0 genes in this pathway
ROSS ACUTE MYELOID LEUKEMIA CBF	82	57	All SZGR 2.0 genes in this pathway
GALINDO IMMUNE RESPONSE TO ENTEROTOXIN	85	67	All SZGR 2.0 genes in this pathway
ZHAN MULTIPLE MYELOMA SPIKED	22	13	All SZGR 2.0 genes in this pathway
BASSO CD40 SIGNALING UP	101	76	All SZGR 2.0 genes in this pathway
WANG CISPLATIN RESPONSE AND XPC DN	228	146	All SZGR 2.0 genes in this pathway
BURTON ADIPOGENESIS 1	33	24	All SZGR 2.0 genes in this pathway
BILD MYC ONCOGENIC SIGNATURE	206	117	All SZGR 2.0 genes in this pathway
FOSTER TOLERANT MACROPHAGE DN	409	268	All SZGR 2.0 genes in this pathway
HELLER HDAC TARGETS SILENCED BY METHYLATION UP	461	298	All SZGR 2.0 genes in this pathway
MASSARWEH TAMOXIFEN RESISTANCE DN	258	160	All SZGR 2.0 genes in this pathway
WALLACE PROSTATE CANCER RACE UP	299	167	All SZGR 2.0 genes in this pathway
MARZEC IL2 SIGNALING UP	115	80	All SZGR 2.0 genes in this pathway
RIZKI TUMOR INVASIVENESS 3D UP	210	124	All SZGR 2.0 genes in this pathway
RIZKI TUMOR INVASIVENESS 2D UP	69	46	All SZGR 2.0 genes in this pathway
MITSIADES RESPONSE TO APLIDIN UP	439	257	All SZGR 2.0 genes in this pathway
QI PLASMACYTOMA UP	259	185	All SZGR 2.0 genes in this pathway
VANTVEER BREAST CANCER ESR1 DN	240	153	All SZGR 2.0 genes in this pathway
JISON SICKLE CELL DISEASE DN	181	97	All SZGR 2.0 genes in this pathway
YAGI AML WITH INV 16 TRANSLOCATION	422	277	All SZGR 2.0 genes in this pathway
TIAN TNF SIGNALING NOT VIA NFKB	22	16	All SZGR 2.0 genes in this pathway
WONG ADULT TISSUE STEM MODULE	721	492	All SZGR 2.0 genes in this pathway
CHANDRAN METASTASIS DN	306	191	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 30MIN DN	150	99	All SZGR 2.0 genes in this pathway
CHYLA CBFA2T3 TARGETS UP	387	225	All SZGR 2.0 genes in this pathway
BHAT ESR1 TARGETS VIA AKT1 UP	281	183	All SZGR 2.0 genes in this pathway
IVANOVSKA MIR106B TARGETS	90	56	All SZGR 2.0 genes in this pathway
KASLER HDAC7 TARGETS 1 UP	194	133	All SZGR 2.0 genes in this pathway
TORCHIA TARGETS OF EWSR1 FLI1 FUSION DN	321	200	All SZGR 2.0 genes in this pathway
WANG MLL TARGETS	289	188	All SZGR 2.0 genes in this pathway
ALFANO MYC TARGETS	239	156	All SZGR 2.0 genes in this pathway
FORTSCHEGGER PHF8 TARGETS UP	279	155	All SZGR 2.0 genes in this pathway
VANOEVELEN MYOGENESIS SIN3A TARGETS	220	133	All SZGR 2.0 genes in this pathway
HOLLEMAN DAUNORUBICIN ALL UP	7	5	All SZGR 2.0 genes in this pathway
SMIRNOV RESPONSE TO IR 6HR DN	114	69	All SZGR 2.0 genes in this pathway
GHANDHI DIRECT IRRADIATION UP	110	68	All SZGR 2.0 genes in this pathway
GHANDHI BYSTANDER IRRADIATION UP	86	54	All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY	1725	838	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-142-5p	592	599	1A,m8	hsa-miR-142-5p	CAUAAAGUAGAAAGCACUAC
miR-17-5p/20/93.mr/106/519.d	590	597	1A,m8	hsa-miR-17-5p	CAAAGUGCUUACAGUGCAGGUAGU
				hsa-miR-20a^brain	UAAAGUGCUUAUAGUGCAGGUAG
				hsa-miR-106a	AAAAGUGCUUACAGUGCAGGUAGC
				hsa-miR-106b^SZ	UAAAGUGCUGACAGUGCAGAU
				hsa-miR-20b^SZ	CAAAGUGCUCAUAGUGCAGGUAG
				hsa-miR-519d	CAAAGUGCCUCCCUUUAGAGUGU
miR-29	178	184	m8	hsa-miR-29a^SZ	UAGCACCAUCUGAAAUCGGUU
				hsa-miR-29b^SZ	UAGCACCAUUUGAAAUCAGUGUU
				hsa-miR-29c^SZ	UAGCACCAUUUGAAAUCGGU
miR-93.hd/291-3p/294/295/302/372/373/520	589	595	m8	hsa-miR-93^brain	AAAGUGCUGUUCGUGCAGGUAG
				hsa-miR-302a	UAAGUGCUUCCAUGUUUUGGUGA
				hsa-miR-302b	UAAGUGCUUCCAUGUUUUAGUAG
				hsa-miR-302c	UAAGUGCUUCCAUGUUUCAGUGG
				hsa-miR-302d	UAAGUGCUUCCAUGUUUGAGUGU
				hsa-miR-372	AAAGUGCUGCGACAUUUGAGCGU
				hsa-miR-373	GAAGUGCUUCGAUUUUGGGGUGU
				hsa-miR-520e	AAAGUGCUUCCUUUUUGAGGG
				hsa-miR-520a	AAAGUGCUUCCCUUUGGACUGU
				hsa-miR-520b	AAAGUGCUUCCUUUUAGAGGG
				hsa-miR-520c	AAAGUGCUUCCUUUUAGAGGGUU
				hsa-miR-520d	AAAGUGCUUCUCUUUGGUGGGUU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: DUSP2