SZGR2

Summary ?

GeneID	2035
Symbol	EPB41
Synonyms	4.1R\|EL1\|HE
Description	erythrocyte membrane protein band 4.1
Reference	MIM:130500\|HGNC:HGNC:3377\|Ensembl:ENSG00000159023\|HPRD:00558\|Vega:OTTHUMG00000003644
Gene type	protein-coding
Map location	1p33-p32
Pascal p-value	8.17E-5
Fetal beta	2.665
DMG	1 (# studies)
eGene	Cerebellum
Support	CompositeSet

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	1
DNM:Fromer_2014	Whole Exome Sequencing analysis	This study reported a WES study of 623 schizophrenia trios, reporting DNMs using genomic DNA.
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 3.9116

Section I. Genetics and epigenetics annotation

DNM table

Gene	Chromosome	Position	Ref	Alt	Transcript	AA change	Mutation type	Sift	CG46	Trait	Study
EPB41	chr1	29344918	T	TTGA	NM_001166005 NM_001166006 NM_001166007 NM_004437 NM_203342 NM_203343	. . . . . .	out-of-frame-codon-insertion out-of-frame-codon-insertion out-of-frame-codon-insertion out-of-frame-codon-insertion out-of-frame-codon-insertion out-of-frame-codon-insertion			Schizophrenia	DNM:Fromer_2014

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg07154196	1	29214064	EPB41	1.895E-4	-0.338	0.034	DMG:Wockner_2014

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
PTBP1	0.93	0.82
TGIF2	0.92	0.73
SMO	0.90	0.80
TP53	0.89	0.73
ITPRIP	0.89	0.74
CHST14	0.89	0.79
ERBB2	0.88	0.81
TEAD2	0.88	0.66
TCF19	0.88	0.61
CDK2	0.88	0.66

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
C5orf53	-0.46	-0.53
CCNI2	-0.41	-0.45
CHN1	-0.41	-0.48
OMG	-0.41	-0.48
CA11	-0.40	-0.46
SERPINI1	-0.40	-0.49
EPHX4	-0.40	-0.51
CKMT1A	-0.40	-0.45
ACOT13	-0.40	-0.50
ACYP2	-0.39	-0.45

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003779	actin binding	IEA		-
GO:0005545	phosphatidylinositol binding	IDA		16669616
GO:0005488	binding	IEA		-
GO:0005198	structural molecule activity	IEA		-
GO:0005200	structural constituent of cytoskeleton	TAS		6894932
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0008015	blood circulation	TAS		6894932
GO:0030866	cortical actin cytoskeleton organization	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005856	cytoskeleton	IEA		-
GO:0005634	nucleus	IEA		-
GO:0005737	cytoplasm	IEA		-
GO:0008091	spectrin	TAS		6894932
GO:0005886	plasma membrane	TAS		9598318
GO:0019898	extrinsic to membrane	IEA		-
GO:0043234	protein complex	IDA		16060676
GO:0030863	cortical cytoskeleton	IDA		16254212

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ACTA1	ACTA \| ASMA \| CFTD \| CFTD1 \| CFTDM \| MPFD \| NEM1 \| NEM2 \| NEM3	actin, alpha 1, skeletal muscle	-	HPRD	11071908
CALR	CRT \| FLJ26680 \| RO \| SSA \| cC1qR	calreticulin	Affinity Capture-MS	BioGRID	17353931
CASK	CAGH39 \| CMG \| FLJ22219 \| FLJ31914 \| LIN2 \| MICPCH \| TNRC8	calcium/calmodulin-dependent serine protein kinase (MAGUK family)	-	HPRD,BioGRID	9660868
CD44	CDW44 \| CSPG8 \| ECMR-III \| HCELL \| IN \| LHR \| MC56 \| MDU2 \| MDU3 \| MGC10468 \| MIC4 \| MUTCH-I \| Pgp1	CD44 molecule (Indian blood group)	-	HPRD	12901833
CDK2	p33(CDK2)	cyclin-dependent kinase 2	Affinity Capture-MS	BioGRID	17353931
CENPJ	BM032 \| CPAP \| LAP \| LIP1 \| MCPH6 \| MGC131581 \| MGC131582 \| MGC142222 \| MGC142224	centromere protein J	-	HPRD,BioGRID	11003675
DCTN1	DAP-150 \| DP-150 \| HMN7B \| P135	dynactin 1 (p150, glued homolog, Drosophila)	Affinity Capture-Western	BioGRID	10189366
DLG1	DKFZp761P0818 \| DKFZp781B0426 \| DLGH1 \| SAP97 \| dJ1061C18.1.1 \| hdlg	discs, large homolog 1 (Drosophila)	-	HPRD,BioGRID	7937897
DRD2	D2DR \| D2R	dopamine receptor D2	-	HPRD	12181426
DRD3	D3DR \| ETM1 \| FET1 \| MGC149204 \| MGC149205	dopamine receptor D3	-	HPRD	12181426
DYNC1H1	DHC1 \| DHC1a \| DKFZp686P2245 \| DNCH1 \| DNCL \| DNECL \| DYHC \| Dnchc1 \| HL-3 \| KIAA0325 \| p22	dynein, cytoplasmic 1, heavy chain 1	Affinity Capture-Western	BioGRID	10189366
ECHS1	SCEH	enoyl Coenzyme A hydratase, short chain, 1, mitochondrial	Affinity Capture-MS	BioGRID	17353931
EIF3G	EIF3-P42 \| EIF3S4 \| eIF3-delta \| eIF3-p44	eukaryotic translation initiation factor 3, subunit G	-	HPRD,BioGRID	10887144
EPB42	MGC116735 \| MGC116737 \| PA	erythrocyte membrane protein band 4.2	-	HPRD	2968981
GYPC	CD236 \| CD236R \| GE \| GPC \| GYPD \| MGC117309 \| MGC126191 \| MGC126192	glycophorin C (Gerbich blood group)	-	HPRD	11423550
KPNA2	IPOA1 \| QIP2 \| RCH1 \| SRP1alpha	karyopherin alpha 2 (RAG cohort 1, importin alpha 1)	-	HPRD,BioGRID	10359596
MYH9	DFNA17 \| EPSTS \| FTNS \| MGC104539 \| MHA \| NMHC-II-A \| NMMHCA	myosin, heavy chain 9, non-muscle	Affinity Capture-MS	BioGRID	17353931
MYL1	MLC1F \| MLC3F	myosin, light chain 1, alkali; skeletal, fast	-	HPRD	11071908
NPPA	ANF \| ANP \| ATFB6 \| CDD-ANF \| PND	natriuretic peptide precursor A	Reconstituted Complex	BioGRID	12542678
NUMA1	NUMA	nuclear mitotic apparatus protein 1	-	HPRD,BioGRID	10189366
PAICS	ADE2 \| ADE2H1 \| AIRC \| DKFZp781N1372 \| MGC1343 \| MGC5024 \| PAIS	phosphoribosylaminoimidazole carboxylase, phosphoribosylaminoimidazole succinocarboxamide synthetase	Affinity Capture-MS	BioGRID	17353931
PFAS	FGAMS \| FGARAT \| KIAA0361 \| PURL	phosphoribosylformylglycinamidine synthase	Affinity Capture-MS	BioGRID	17353931
SLC4A1	AE1 \| BND3 \| CD233 \| DI \| EMPB3 \| EPB3 \| FR \| MGC116750 \| MGC116753 \| MGC126619 \| MGC126623 \| RTA1A \| SW \| WD \| WD1 \| WR	solute carrier family 4, anion exchanger, member 1 (erythrocyte membrane protein band 3, Diego blood group)	-	HPRD	1639060
SPTAN1	(ALPHA)II-SPECTRIN \| FLJ44613 \| NEAS	spectrin, alpha, non-erythrocytic 1 (alpha-fodrin)	Reconstituted Complex	BioGRID	12044158
SPTAN1	(ALPHA)II-SPECTRIN \| FLJ44613 \| NEAS	spectrin, alpha, non-erythrocytic 1 (alpha-fodrin)	-	HPRD	12049649
SPTB	HSpTB1	spectrin, beta, erythrocytic	-	HPRD,BioGRID	7673158
SPTBN1	ELF \| SPTB2 \| betaSpII	spectrin, beta, non-erythrocytic 1	-	HPRD	12901833
TAGLN2	HA1756 \| KIAA0120	transgelin 2	Affinity Capture-MS	BioGRID	17353931
TJP2	MGC26306 \| X104 \| ZO-2 \| ZO2	tight junction protein 2 (zona occludens 2)	-	HPRD,BioGRID	10874042
TPM1	C15orf13 \| CMD1Y \| HTM-alpha \| TMSA	tropomyosin 1 (alpha)	-	HPRD	11071908
U2AF1	DKFZp313J1712 \| FP793 \| RN \| RNU2AF1 \| U2AF35 \| U2AFBP	U2 small nuclear RNA auxiliary factor 1	-	HPRD	9645944
VARS	G7A \| VARS1 \| VARS2	valyl-tRNA synthetase	Affinity Capture-MS	BioGRID	17353931

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG TIGHT JUNCTION	134	86	All SZGR 2.0 genes in this pathway
PID SYNDECAN 2 PATHWAY	33	27	All SZGR 2.0 genes in this pathway
BERTUCCI MEDULLARY VS DUCTAL BREAST CANCER UP	206	111	All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE LIVE UP	485	293	All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP	1382	904	All SZGR 2.0 genes in this pathway
DEURIG T CELL PROLYMPHOCYTIC LEUKEMIA UP	368	234	All SZGR 2.0 genes in this pathway
BOGNI TREATMENT RELATED MYELOID LEUKEMIA UP	30	19	All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE LPS UP	431	237	All SZGR 2.0 genes in this pathway
KINSEY TARGETS OF EWSR1 FLII FUSION UP	1278	748	All SZGR 2.0 genes in this pathway
CONCANNON APOPTOSIS BY EPOXOMICIN UP	239	157	All SZGR 2.0 genes in this pathway
GAUSSMANN MLL AF4 FUSION TARGETS G UP	238	135	All SZGR 2.0 genes in this pathway
LASTOWSKA NEUROBLASTOMA COPY NUMBER DN	800	473	All SZGR 2.0 genes in this pathway
PEREZ TP53 TARGETS	1174	695	All SZGR 2.0 genes in this pathway
RASHI RESPONSE TO IONIZING RADIATION 5	147	89	All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK	1652	1023	All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK	1442	892	All SZGR 2.0 genes in this pathway
PUJANA CHEK2 PCC NETWORK	779	480	All SZGR 2.0 genes in this pathway
WEI MIR34A TARGETS	148	97	All SZGR 2.0 genes in this pathway
RICKMAN TUMOR DIFFERENTIATED WELL VS POORLY UP	236	139	All SZGR 2.0 genes in this pathway
SAKAI TUMOR INFILTRATING MONOCYTES DN	81	51	All SZGR 2.0 genes in this pathway
SU PANCREAS	54	30	All SZGR 2.0 genes in this pathway
MCCLUNG CREB1 TARGETS DN	57	39	All SZGR 2.0 genes in this pathway
ULE SPLICING VIA NOVA2	43	38	All SZGR 2.0 genes in this pathway
MCCLUNG COCAIN REWARD 4WK	75	47	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 6HR DN	160	101	All SZGR 2.0 genes in this pathway
MARTINEZ RESPONSE TO TRABECTEDIN DN	271	175	All SZGR 2.0 genes in this pathway
ZHENG BOUND BY FOXP3	491	310	All SZGR 2.0 genes in this pathway
ZHENG FOXP3 TARGETS IN THYMUS DN	12	9	All SZGR 2.0 genes in this pathway
SANSOM APC MYC TARGETS	217	138	All SZGR 2.0 genes in this pathway
RIZKI TUMOR INVASIVENESS 3D DN	270	181	All SZGR 2.0 genes in this pathway
SWEET LUNG CANCER KRAS DN	435	289	All SZGR 2.0 genes in this pathway
LEE DIFFERENTIATING T LYMPHOCYTE	200	115	All SZGR 2.0 genes in this pathway
HAN SATB1 TARGETS UP	395	249	All SZGR 2.0 genes in this pathway
CHEN METABOLIC SYNDROM NETWORK	1210	725	All SZGR 2.0 genes in this pathway
VALK AML CLUSTER 7	28	16	All SZGR 2.0 genes in this pathway
YAGI AML WITH T 8 21 TRANSLOCATION	368	247	All SZGR 2.0 genes in this pathway
CHANDRAN METASTASIS UP	221	135	All SZGR 2.0 genes in this pathway
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 11	103	68	All SZGR 2.0 genes in this pathway
VERHAAK GLIOBLASTOMA PRONEURAL	177	132	All SZGR 2.0 genes in this pathway
DUTERTRE ESTRADIOL RESPONSE 24HR DN	505	328	All SZGR 2.0 genes in this pathway
WIERENGA STAT5A TARGETS UP	217	131	All SZGR 2.0 genes in this pathway
MIYAGAWA TARGETS OF EWSR1 ETS FUSIONS UP	259	159	All SZGR 2.0 genes in this pathway
STEINER ERYTHROCYTE MEMBRANE GENES	15	10	All SZGR 2.0 genes in this pathway
LIM MAMMARY STEM CELL DN	428	246	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-128	703	709	1A	hsa-miR-128a	UCACAGUGAACCGGUCUCUUUU
miR-128	703	709	1A	hsa-miR-128b	UCACAGUGAACCGGUCUCUUUC
miR-144	701	707	m8	hsa-miR-144	UACAGUAUAGAUGAUGUACUAG
miR-205	2991	2998	1A,m8	hsa-miR-205	UCCUUCAUUCCACCGGAGUCUG
miR-27	703	710	1A,m8	hsa-miR-27a^brain	UUCACAGUGGCUAAGUUCCGC
miR-27	703	710	1A,m8	hsa-miR-27b^brain	UUCACAGUGGCUAAGUUCUGC
miR-30-5p	3042	3049	1A,m8	hsa-miR-30a-5p	UGUAAACAUCCUCGACUGGAAG
				hsa-miR-30c^brain	UGUAAACAUCCUACACUCUCAGC
				hsa-miR-30d^SZ	UGUAAACAUCCCCGACUGGAAG
				hsa-miR-30b^SZ	UGUAAACAUCCUACACUCAGCU
				hsa-miR-30e-5p	UGUAAACAUCCUUGACUGGA
miR-331	944	950	1A	hsa-miR-331^brain	GCCCCUGGGCCUAUCCUAGAA
miR-377	2495	2502	1A,m8	hsa-miR-377	AUCACACAAAGGCAACUUUUGU
miR-381	3190	3196	m8	hsa-miR-381	UAUACAAGGGCAAGCUCUCUGU
miR-504	2560	2567	1A,m8	hsa-miR-504	AGACCCUGGUCUGCACUCUAU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: EPB41