SZGR2

Summary ?

GeneID	2199
Symbol	FBLN2
Synonyms	-
Description	fibulin 2
Reference	MIM:135821\|HGNC:HGNC:3601\|Ensembl:ENSG00000163520\|HPRD:00630\|Vega:OTTHUMG00000155437
Gene type	protein-coding
Map location	3p25.1
Pascal p-value	0.815
Sherlock p-value	0.766
Fetal beta	-2.424
DMG	1 (# studies)
eGene	Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:GWASdb	Genome-wide Association Studies	GWASdb records for schizophrenia
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	1
GSMA_I	Genome scan meta-analysis	Psr: 0.006

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg23043139	3	13678918	FBLN2	1.46E-4	0.345	0.031	DMG:Wockner_2014

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs17646919	chr22	30400860	FBLN2	2199		0.01		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
SIGLEC10	0.87	0.79
FCGR2A	0.84	0.78
LAPTM5	0.83	0.78
ITGB2	0.83	0.77
NCKAP1L	0.82	0.75
SIGLEC8	0.82	0.72
LCP1	0.82	0.76
HCK	0.82	0.72
TLR7	0.80	0.71
CD53	0.80	0.77

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AC098691.2	-0.27	-0.36
AF347015.18	-0.24	-0.27
AC016705.1	-0.23	-0.21
AC010300.1	-0.22	-0.30
ANP32C	-0.21	-0.20
MT-CO2	-0.21	-0.27
AF347015.21	-0.21	-0.24
AC100783.1	-0.21	-0.22
AF347015.26	-0.21	-0.22
AC073957.1	-0.21	-0.21

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005509	calcium ion binding	IEA		-
GO:0005509	calcium ion binding	TAS		7806230
GO:0005201	extracellular matrix structural constituent	TAS		7806230
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005576	extracellular region	IEA		-
GO:0005578	proteinaceous extracellular matrix	TAS		7806230

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ACAN	AGC1 \| AGCAN \| CSPG1 \| CSPGCP \| MSK16 \| SEDK	aggrecan	-	HPRD,BioGRID	11038354
BCAN	BEHAB \| CSPG7 \| MGC13038	brevican	-	HPRD,BioGRID	11038354
COL18A1	FLJ27325 \| FLJ34914 \| KNO \| KNO1 \| MGC74745	collagen, type XVIII, alpha 1	-	HPRD	10544250
COL4A1	arresten	collagen, type IV, alpha 1	-	HPRD,BioGRID	7500359
COL4A2	DKFZp686I14213 \| FLJ22259	collagen, type IV, alpha 2	-	HPRD,BioGRID	7500359
COL4A3	-	collagen, type IV, alpha 3 (Goodpasture antigen)	-	HPRD,BioGRID	7500359
COL4A4	CA44	collagen, type IV, alpha 4	-	HPRD,BioGRID	7500359
COL4A5	ASLN \| ATS \| CA54 \| MGC167109 \| MGC42377	collagen, type IV, alpha 5	-	HPRD,BioGRID	7500359
COL4A6	MGC88184	collagen, type IV, alpha 6	-	HPRD,BioGRID	7500359
ELN	FLJ38671 \| FLJ43523 \| SVAS \| WBS \| WS	elastin	-	HPRD,BioGRID	10544250
FBLN2	-	fibulin 2	-	HPRD,BioGRID	9214621
FBN1	FBN \| MASS \| MFS1 \| OCTD \| SGS \| WMS	fibrillin 1	Fibrillin-1 interacts with Fibulin-2.	BIND	8702639
FBN1	FBN \| MASS \| MFS1 \| OCTD \| SGS \| WMS	fibrillin 1	-	HPRD,BioGRID	8702639 \|9886271
FN1	CIG \| DKFZp686F10164 \| DKFZp686H0342 \| DKFZp686I1370 \| DKFZp686O13149 \| ED-B \| FINC \| FN \| FNZ \| GFND \| GFND2 \| LETS \| MSF	fibronectin 1	-	HPRD	10848816
HSPG2	PLC \| PRCAN \| SJA \| SJS \| SJS1	heparan sulfate proteoglycan 2	-	HPRD	9431988
HSPG2	PLC \| PRCAN \| SJA \| SJS \| SJS1	heparan sulfate proteoglycan 2	Reconstituted Complex	BioGRID	11493006
LAMA1	LAMA	laminin, alpha 1	-	HPRD,BioGRID	9006922 \|10934193
LAMA5	KIAA1907	laminin, alpha 5	-	HPRD,BioGRID	9006922
LAMC2	B2T \| BM600 \| CSF \| EBR2 \| EBR2A \| LAMB2T \| LAMNB2 \| MGC138491 \| MGC141938	laminin, gamma 2	-	HPRD	11733994
NID1	NID	nidogen 1	-	HPRD,BioGRID	7500359 \|11493006
PRELP	MGC45323 \| MST161 \| MSTP161 \| SLRR2A	proline/arginine-rich end leucine-rich repeat protein	-	HPRD,BioGRID	11847210
VCAN	CSPG2 \| DKFZp686K06110 \| ERVR \| PG-M \| WGN \| WGN1	versican	-	HPRD,BioGRID	11038354

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
SCHUETZ BREAST CANCER DUCTAL INVASIVE UP	351	230	All SZGR 2.0 genes in this pathway
CASTELLANO NRAS TARGETS DN	14	14	All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 1 DN	378	231	All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 2B	392	251	All SZGR 2.0 genes in this pathway
GRUETZMANN PANCREATIC CANCER UP	358	245	All SZGR 2.0 genes in this pathway
SASAI RESISTANCE TO NEOPLASTIC TRANSFROMATION	50	31	All SZGR 2.0 genes in this pathway
KOYAMA SEMA3B TARGETS DN	411	249	All SZGR 2.0 genes in this pathway
GOTZMANN EPITHELIAL TO MESENCHYMAL TRANSITION UP	69	55	All SZGR 2.0 genes in this pathway
SUNG METASTASIS STROMA UP	110	70	All SZGR 2.0 genes in this pathway
LEE LIVER CANCER DENA UP	60	40	All SZGR 2.0 genes in this pathway
NADLER OBESITY UP	61	34	All SZGR 2.0 genes in this pathway
GUO HEX TARGETS UP	81	54	All SZGR 2.0 genes in this pathway
ZHAN MULTIPLE MYELOMA SPIKED	22	13	All SZGR 2.0 genes in this pathway
IGLESIAS E2F TARGETS UP	151	103	All SZGR 2.0 genes in this pathway
KAAB HEART ATRIUM VS VENTRICLE UP	249	170	All SZGR 2.0 genes in this pathway
YAMAZAKI TCEB3 TARGETS UP	175	116	All SZGR 2.0 genes in this pathway
BURTON ADIPOGENESIS 7	51	34	All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS STEM CELL AND PROGENITOR	681	420	All SZGR 2.0 genes in this pathway
RAMASWAMY METASTASIS UP	66	43	All SZGR 2.0 genes in this pathway
LEE CALORIE RESTRICTION MUSCLE DN	51	28	All SZGR 2.0 genes in this pathway
SANSOM APC TARGETS	212	121	All SZGR 2.0 genes in this pathway
KYNG DNA DAMAGE BY 4NQO	38	24	All SZGR 2.0 genes in this pathway
KYNG DNA DAMAGE DN	195	135	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS UP	673	430	All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS UP	602	364	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS DN	591	366	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER LUMINAL B DN	564	326	All SZGR 2.0 genes in this pathway
MCGARVEY SILENCED BY METHYLATION IN COLON CANCER	42	29	All SZGR 2.0 genes in this pathway
ZHENG GLIOBLASTOMA PLASTICITY UP	250	168	All SZGR 2.0 genes in this pathway
LABBE WNT3A TARGETS UP	112	71	All SZGR 2.0 genes in this pathway
LABBE TGFB1 TARGETS UP	102	64	All SZGR 2.0 genes in this pathway
LABBE TARGETS OF TGFB1 AND WNT3A UP	111	70	All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS 60HR DN	277	166	All SZGR 2.0 genes in this pathway
CHEN METABOLIC SYNDROM NETWORK	1210	725	All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3	1069	729	All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA CHEMOTAXIS DN	457	302	All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2	491	319	All SZGR 2.0 genes in this pathway
WONG ADULT TISSUE STEM MODULE	721	492	All SZGR 2.0 genes in this pathway
KARLSSON TGFB1 TARGETS UP	127	78	All SZGR 2.0 genes in this pathway
PLASARI TGFB1 TARGETS 1HR UP	34	26	All SZGR 2.0 genes in this pathway
DELACROIX RARG BOUND MEF	367	231	All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY	1725	838	All SZGR 2.0 genes in this pathway
NABA ECM GLYCOPROTEINS	196	99	All SZGR 2.0 genes in this pathway
NABA CORE MATRISOME	275	148	All SZGR 2.0 genes in this pathway
NABA MATRISOME	1028	559	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-128	355	362	1A,m8	hsa-miR-128a	UCACAGUGAACCGGUCUCUUUU
miR-128	355	362	1A,m8	hsa-miR-128b	UCACAGUGAACCGGUCUCUUUC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: FBLN2