SZGR2

Summary ?

GeneID	22986
Symbol	SORCS3
Synonyms	SORCS
Description	sortilin related VPS10 domain containing receptor 3
Reference	MIM:606285\|HGNC:HGNC:16699\|Ensembl:ENSG00000156395\|HPRD:12100\|Vega:OTTHUMG00000019011
Gene type	protein-coding
Map location	10q23-q25
Pascal p-value	1.925E-5
Sherlock p-value	0.096
eGene	Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 2

Section I. Genetics and epigenetics annotation

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	qvalue	eQTL type
rs12063095	chr1	85975456	SORCS3	22986	0.15	trans
rs16866571	chr2	8161537	SORCS3	22986	0.02	trans
rs9311908	chr3	64702173	SORCS3	22986	0.06	trans
rs10516815	chr4	89587324	SORCS3	22986	0.06	trans
rs2860259	chr4	89587833	SORCS3	22986	0.14	trans
rs848400	chr7	108525043	SORCS3	22986	0.03	trans
rs2253255	chr8	97522542	SORCS3	22986	0.15	trans
rs10501658	chr11	87788891	SORCS3	22986	0.05	trans
snp_a-4223854		0	SORCS3	22986	0.08	trans
rs16978564	chr18	44037097	SORCS3	22986	4.454E-4	trans
rs11796450	chrX	3983128	SORCS3	22986	0	trans
rs16978802	chrX	3998040	SORCS3	22986	0	trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
TRIM24	0.91	0.91
CHST10	0.90	0.90
ZNF480	0.89	0.84
EML4	0.88	0.91
C20orf74	0.88	0.90
KDM5B	0.88	0.91
ATF7IP	0.88	0.90
NONO	0.88	0.90
ALDH18A1	0.88	0.90
PRRC1	0.88	0.89

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
C5orf53	-0.66	-0.76
HLA-F	-0.64	-0.75
AF347015.27	-0.63	-0.85
FXYD1	-0.63	-0.84
S100B	-0.62	-0.79
AF347015.31	-0.62	-0.83
TSC22D4	-0.62	-0.76
MT-CO2	-0.62	-0.85
AF347015.33	-0.62	-0.82
SLC16A11	-0.62	-0.65

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0008188	neuropeptide receptor activity	NAS	Neurotransmitter (GO term level: 8)	11499680
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007218	neuropeptide signaling pathway	NAS	Neurotransmitter (GO term level: 8)	11499680
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0016020	membrane	NAS		11499680
GO:0016021	integral to membrane	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
REACTOME SIGNALLING BY NGF	217	167	All SZGR 2.0 genes in this pathway
REACTOME P75 NTR RECEPTOR MEDIATED SIGNALLING	81	61	All SZGR 2.0 genes in this pathway
CHEBOTAEV GR TARGETS DN	120	73	All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS	1038	678	All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS	1062	725	All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3	1118	744	All SZGR 2.0 genes in this pathway
BENPORATH PRC2 TARGETS	652	441	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN	1237	837	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 18HR UP	178	111	All SZGR 2.0 genes in this pathway
ACEVEDO METHYLATED IN LIVER CANCER DN	940	425	All SZGR 2.0 genes in this pathway
LIN NPAS4 TARGETS DN	68	48	All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2 AND H3K27ME3	349	234	All SZGR 2.0 genes in this pathway
MIKKELSEN IPS WITH HCP H3K27ME3	102	76	All SZGR 2.0 genes in this pathway
MIKKELSEN NPC HCP WITH H3K27ME3	341	243	All SZGR 2.0 genes in this pathway
MIKKELSEN MEF HCP WITH H3K27ME3	590	403	All SZGR 2.0 genes in this pathway
VERHAAK GLIOBLASTOMA PRONEURAL	177	132	All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY	1725	838	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-101	1802	1808	1A	hsa-miR-101	UACAGUACUGUGAUAACUGAAG
miR-144	1764	1770	m8	hsa-miR-144	UACAGUAUAGAUGAUGUACUAG
miR-144	1764	1770	m8	hsa-miR-144	UACAGUAUAGAUGAUGUACUAG
miR-30-5p	100	106	m8	hsa-miR-30a-5p	UGUAAACAUCCUCGACUGGAAG
				hsa-miR-30c^brain	UGUAAACAUCCUACACUCUCAGC
				hsa-miR-30d^SZ	UGUAAACAUCCCCGACUGGAAG
				hsa-miR-30b^SZ	UGUAAACAUCCUACACUCAGCU
				hsa-miR-30e-5p	UGUAAACAUCCUUGACUGGA
miR-342	1578	1584	1A	hsa-miR-342^brain	UCUCACACAGAAAUCGCACCCGUC
miR-346	1685	1692	1A,m8	hsa-miR-346^brain	UGUCUGCCCGCAUGCCUGCCUCU
miR-382	1284	1290	m8	hsa-miR-382^brain	GAAGUUGUUCGUGGUGGAUUCG
miR-493-5p	1756	1762	m8	hsa-miR-493-5p	UUGUACAUGGUAGGCUUUCAUU
miR-493-5p	1756	1762	m8	hsa-miR-493-5p	UUGUACAUGGUAGGCUUUCAUU
miR-496	544	550	1A	hsa-miR-496	AUUACAUGGCCAAUCUC
miR-505	1833	1839	1A	hsa-miR-505	GUCAACACUUGCUGGUUUCCUC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: SORCS3