Gene Page: ABL1
Summary ?
GeneID | 25 |
Symbol | ABL1 |
Synonyms | ABL|JTK7|bcr/abl|c-ABL|c-ABL1|p150|v-abl |
Description | ABL proto-oncogene 1, non-receptor tyrosine kinase |
Reference | MIM:189980|HGNC:HGNC:76|Ensembl:ENSG00000097007|HPRD:01809|Vega:OTTHUMG00000020813 |
Gene type | protein-coding |
Map location | 9q34.1 |
Pascal p-value | 0.23 |
Sherlock p-value | 0.025 |
Fetal beta | 1.012 |
Support | Ascano FMRP targets |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 1.1761 |
Section I. Genetics and epigenetics annotation
DNM table
Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
---|---|---|---|---|---|---|---|---|---|---|---|
ABL1 | chr9 | 133750294 | C | T | NM_005157 NM_007313 | . . | silent silent | Schizophrenia | DNM:Fromer_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0000166 | nucleotide binding | IEA | - | |
GO:0000287 | magnesium ion binding | IDA | 9144171 | |
GO:0004872 | receptor activity | IEA | - | |
GO:0003674 | molecular_function | ND | - | |
GO:0003677 | DNA binding | NAS | 8242749 | |
GO:0005515 | protein binding | IEA | - | |
GO:0005524 | ATP binding | IDA | 9144171 | |
GO:0004715 | non-membrane spanning protein tyrosine kinase activity | IEA | - | |
GO:0016740 | transferase activity | IEA | - | |
GO:0008022 | protein C-terminus binding | IPI | 11971963 | |
GO:0016301 | kinase activity | IEA | - | |
GO:0030145 | manganese ion binding | IDA | 9144171 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0000115 | regulation of transcription during S-phase of mitotic cell cycle | TAS | 8242749 | |
GO:0006355 | regulation of transcription, DNA-dependent | TAS | 8242749 | |
GO:0007155 | cell adhesion | IEA | - | |
GO:0006298 | mismatch repair | TAS | 10391249 | |
GO:0006464 | protein modification process | NAS | 8242749 | |
GO:0008630 | DNA damage response, signal transduction resulting in induction of apoptosis | TAS | 10391249 | |
GO:0008150 | biological_process | ND | - | |
GO:0018108 | peptidyl-tyrosine phosphorylation | IDA | 9144171 | |
GO:0030036 | actin cytoskeleton organization | ISS | - | |
GO:0051353 | positive regulation of oxidoreductase activity | IDA | 12893824 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005856 | cytoskeleton | IEA | - | |
GO:0005575 | cellular_component | ND | - | |
GO:0005634 | nucleus | NAS | 8242749 | |
GO:0005730 | nucleolus | IDA | 12944467 | |
GO:0005737 | cytoplasm | IEA | - |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
ABI1 | ABI-1 | E3B1 | NAP1BP | SSH3BP | SSH3BP1 | abl-interactor 1 | - | HPRD | 9010225 |12672821 |
ABI1 | ABI-1 | E3B1 | NAP1BP | SSH3BP | SSH3BP1 | abl-interactor 1 | hNap1BP interacts with Abl. | BIND | 11418237 |
ABI1 | ABI-1 | E3B1 | NAP1BP | SSH3BP | SSH3BP1 | abl-interactor 1 | Affinity Capture-Western Reconstituted Complex | BioGRID | 9010225 |11418237 |12672821 |
ABI2 | ABI-2 | ABI2B | AIP-1 | AblBP3 | SSH3BP2 | argBPIA | argBPIB | abl interactor 2 | - | HPRD,BioGRID | 7590236 |
ABL1 | ABL | JTK7 | bcr/abl | c-ABL | p150 | v-abl | c-abl oncogene 1, receptor tyrosine kinase | Protein-peptide | BioGRID | 12654250 |
ABL1 | ABL | JTK7 | bcr/abl | c-ABL | p150 | v-abl | c-abl oncogene 1, receptor tyrosine kinase | c-Abl 1b interacts with itself in trans via the SH2 domain. | BIND | 1383690 |
ABL2 | ABLL | ARG | FLJ22224 | FLJ31718 | FLJ41441 | v-abl Abelson murine leukemia viral oncogene homolog 2 (arg, Abelson-related gene) | - | HPRD,BioGRID | 12569093 |
ABL2 | ABLL | ARG | FLJ22224 | FLJ31718 | FLJ41441 | v-abl Abelson murine leukemia viral oncogene homolog 2 (arg, Abelson-related gene) | ABL1 (c-Abl) phosphorylates ABL2 (Arg). | BIND | 15735735 |
ABL2 | ABLL | ARG | FLJ22224 | FLJ31718 | FLJ41441 | v-abl Abelson murine leukemia viral oncogene homolog 2 (arg, Abelson-related gene) | c-Abl interacts with ARG. | BIND | 1383690 |
ADAM15 | MDC15 | ADAM metallopeptidase domain 15 | - | HPRD | 11741929 |
APBB1 | FE65 | MGC:9072 | RIR | amyloid beta (A4) precursor protein-binding, family B, member 1 (Fe65) | - | HPRD | 11279131 |
APP | AAA | ABETA | ABPP | AD1 | APPI | CTFgamma | CVAP | PN2 | amyloid beta (A4) precursor protein | - | HPRD | 11279131 |
ARHGAP17 | DKFZp564A1363 | FLJ37567 | FLJ43368 | MGC87805 | MST066 | MST110 | MSTP038 | MSTP066 | MSTP110 | NADRIN | RICH1 | WBP15 | Rho GTPase activating protein 17 | Reconstituted Complex | BioGRID | 11431473 |
ATM | AT1 | ATA | ATC | ATD | ATDC | ATE | DKFZp781A0353 | MGC74674 | TEL1 | TELO1 | ataxia telangiectasia mutated | - | HPRD,BioGRID | 9168117 |
ATR | FRP1 | MEC1 | SCKL | SCKL1 | ataxia telangiectasia and Rad3 related | Protein-peptide | BioGRID | 10608806 |
BCAR1 | CAS | CAS1 | CASS1 | CRKAS | P130Cas | breast cancer anti-estrogen resistance 1 | - | HPRD,BioGRID | 7780740 |
BCR | ALL | BCR-ABL1 | BCR1 | CML | D22S11 | D22S662 | FLJ16453 | PHL | breakpoint cluster region | BCR interacts with c-Abl. This interaction was modeled on a demonstrated interaction between BCR from an unspecified source and human c-Abl. | BIND | 1383690 |
BCR | ALL | BCR-ABL1 | BCR1 | CML | D22S11 | D22S662 | FLJ16453 | PHL | breakpoint cluster region | - | HPRD | 11780146 |
BCR | ALL | BCR-ABL1 | BCR1 | CML | D22S11 | D22S662 | FLJ16453 | PHL | breakpoint cluster region | Affinity Capture-Western Reconstituted Complex | BioGRID | 1712671 |8112292 |12543778 |
BIN1 | AMPH2 | AMPHL | DKFZp547F068 | MGC10367 | SH3P9 | bridging integrator 1 | - | HPRD | 9356459 |
BRCA1 | BRCAI | BRCC1 | IRIS | PSCP | RNF53 | breast cancer 1, early onset | Affinity Capture-Western | BioGRID | 12024016 |
C3 | ARMD9 | ASP | CPAMD1 | complement component 3 | - | HPRD | 4062888 |
CABLES2 | C20orf150 | dJ908M14.2 | ik3-2 | Cdk5 and Abl enzyme substrate 2 | - | HPRD,BioGRID | 11955625 |
CASP9 | APAF-3 | APAF3 | CASPASE-9c | ICE-LAP6 | MCH6 | caspase 9, apoptosis-related cysteine peptidase | - | HPRD | 15657060 |
CAT | MGC138422 | MGC138424 | catalase | Affinity Capture-Western Biochemical Activity Reconstituted Complex | BioGRID | 12777400 |
CBL | C-CBL | CBL2 | RNF55 | Cas-Br-M (murine) ecotropic retroviral transforming sequence | - | HPRD,BioGRID | 12475393 |
CREB1 | CREB | MGC9284 | cAMP responsive element binding protein 1 | Reconstituted Complex | BioGRID | 7565761 |
CRK | CRKII | v-crk sarcoma virus CT10 oncogene homolog (avian) | c-Abl interacts with Crk. This interaction was modeled on a demonstrated interaction between human c-Abl and Crk from an unspecified species. | BIND | 15696159 |
CRK | CRKII | v-crk sarcoma virus CT10 oncogene homolog (avian) | Interaction between ABL (PDB ID: 1JU5_C) and CRK (PDB ID: 1JU5_A). | BIND | 12384576 |
CRKL | - | v-crk sarcoma virus CT10 oncogene homolog (avian)-like | Affinity Capture-Western Reconstituted Complex Two-hybrid | BioGRID | 7926767 |8083188 |8978305 |9820532 |
CRKL | - | v-crk sarcoma virus CT10 oncogene homolog (avian)-like | - | HPRD | 7493940 |
CTNND2 | GT24 | NPRAP | catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein) | - | HPRD | 11891774 |
DOK1 | MGC117395 | MGC138860 | P62DOK | docking protein 1, 62kDa (downstream of tyrosine kinase 1) | - | HPRD | 10567556 |
DOK1 | MGC117395 | MGC138860 | P62DOK | docking protein 1, 62kDa (downstream of tyrosine kinase 1) | Affinity Capture-Western Biochemical Activity Reconstituted Complex | BioGRID | 9008161 |11071635 |
DOK3 | DOKL | FLJ22570 | FLJ39939 | docking protein 3 | - | HPRD | 10567556 |
EPHB2 | CAPB | DRT | EPHT3 | ERK | Hek5 | MGC87492 | PCBC | Tyro5 | EPH receptor B2 | - | HPRD,BioGRID | 11494128 |
EVL | RNB6 | Enah/Vasp-like | - | HPRD,BioGRID | 10945997 |
FRAP1 | FLJ44809 | FRAP | FRAP2 | MTOR | RAFT1 | RAPT1 | FK506 binding protein 12-rapamycin associated protein 1 | Affinity Capture-Western | BioGRID | 10753870 |
GPX1 | GSHPX1 | MGC14399 | MGC88245 | glutathione peroxidase 1 | - | HPRD,BioGRID | 12893824 |
GRB10 | GRB-IR | Grb-10 | IRBP | KIAA0207 | MEG1 | RSS | growth factor receptor-bound protein 10 | Affinity Capture-Western Reconstituted Complex | BioGRID | 9006901 |9747873 |
GRB2 | ASH | EGFRBP-GRB2 | Grb3-3 | MST084 | MSTP084 | growth factor receptor-bound protein 2 | - | HPRD | 9516488 |
GRB2 | ASH | EGFRBP-GRB2 | Grb3-3 | MST084 | MSTP084 | growth factor receptor-bound protein 2 | Affinity Capture-Western | BioGRID | 9407116 |
GRIN2D | EB11 | NMDAR2D | glutamate receptor, ionotropic, N-methyl D-aspartate 2D | - | HPRD | 10777567 |
HCK | JTK9 | hemopoietic cell kinase | - | HPRD,BioGRID | 9407116 |
INPPL1 | SHIP2 | inositol polyphosphate phosphatase-like 1 | - | HPRD,BioGRID | 10194451 |
JAK1 | JAK1A | JAK1B | JTK3 | Janus kinase 1 (a protein tyrosine kinase) | Reconstituted Complex | BioGRID | 9774693 |
JAK1 | JAK1A | JAK1B | JTK3 | Janus kinase 1 (a protein tyrosine kinase) | - | HPRD | 12130510 |
MAP4K5 | GCKR | KHS | KHS1 | MAPKKKK5 | mitogen-activated protein kinase kinase kinase kinase 5 | - | HPRD | 9949177 |
MDM2 | HDMX | MGC71221 | hdm2 | Mdm2 p53 binding protein homolog (mouse) | - | HPRD,BioGRID | 12110584 |
MICAL1 | DKFZp434B1517 | FLJ11937 | FLJ21739 | MICAL | MICAL-1 | NICAL | microtubule associated monoxygenase, calponin and LIM domain containing 1 | Reconstituted Complex | BioGRID | 11827972 |
NCF1C | SH3PXD1C | neutrophil cytosolic factor 1C pseudogene | c-Abl interacts with p47phox. | BIND | 12681507 |
NCK1 | MGC12668 | NCK | NCKalpha | NCK adaptor protein 1 | - | HPRD,BioGRID | 11494134 |
NCSTN | APH2 | KIAA0253 | nicastrin | - | HPRD | 12021275 |
NEDD9 | CAS-L | CAS2 | CASL | CASS2 | HEF1 | dJ49G10.2 | dJ761I2.1 | neural precursor cell expressed, developmentally down-regulated 9 | - | HPRD,BioGRID | 8668148 |8879209 |
NTRK1 | DKFZp781I14186 | MTC | TRK | TRK1 | TRKA | p140-TrkA | neurotrophic tyrosine kinase, receptor, type 1 | - | HPRD,BioGRID | 10679771 |10708759 |
PAG1 | CBP | FLJ37858 | MGC138364 | PAG | phosphoprotein associated with glycosphingolipid microdomains 1 | - | HPRD,BioGRID | 9334312 |
PAK2 | PAK65 | PAKgamma | p21 protein (Cdc42/Rac)-activated kinase 2 | - | HPRD,BioGRID | 11121037 |
PDE4D | DPDE3 | HSPDE4D | PDE4DN2 | STRK1 | phosphodiesterase 4D, cAMP-specific (phosphodiesterase E3 dunce homolog, Drosophila) | PDE4D4 interacts with Abl. This interaction was modelled on a demonstrated interaction between human PDE4D4 and abl from an unspecified species. | BIND | 10571082 |
PIK3R1 | GRB1 | p85 | p85-ALPHA | phosphoinositide-3-kinase, regulatory subunit 1 (alpha) | c-Abl interacts with p85. This interaction was modeled on a demonstrated interaction between human c-Abl and bovine p85. | BIND | 1383690 |
PIK3R1 | GRB1 | p85 | p85-ALPHA | phosphoinositide-3-kinase, regulatory subunit 1 (alpha) | Reconstituted Complex | BioGRID | 8294442 |
PLCG1 | PLC-II | PLC1 | PLC148 | PLCgamma1 | phospholipase C, gamma 1 | c-Abl interacts with PLC-gamma1. This interaction was modeled on a demonstrated interaction between human c-Abl and bovine PLCgamma1. | BIND | 1383690 |
PLCG1 | PLC-II | PLC1 | PLC148 | PLCgamma1 | phospholipase C, gamma 1 | Reconstituted Complex | BioGRID | 10708759 |
PLSCR1 | MMTRA1B | phospholipid scramblase 1 | - | HPRD | 11390389 |
PRKDC | DNA-PKcs | DNAPK | DNPK1 | HYRC | HYRC1 | XRCC7 | p350 | protein kinase, DNA-activated, catalytic polypeptide | - | HPRD,BioGRID | 9312071 |
PSTPIP1 | CD2BP1 | CD2BP1L | CD2BP1S | H-PIP | PAPAS | PSTPIP | proline-serine-threonine phosphatase interacting protein 1 | - | HPRD,BioGRID | 11163214 |
PTPN6 | HCP | HCPH | HPTP1C | PTP-1C | SH-PTP1 | SHP-1 | SHP-1L | SHP1 | protein tyrosine phosphatase, non-receptor type 6 | Affinity Capture-Western | BioGRID | 8692915 |
PXN | FLJ16691 | paxillin | - | HPRD | 9603926 |
RAD51 | BRCC5 | HRAD51 | HsRad51 | HsT16930 | RAD51A | RECA | RAD51 homolog (RecA homolog, E. coli) (S. cerevisiae) | Affinity Capture-Western Reconstituted Complex | BioGRID | 10212258 |
RAD52 | - | RAD52 homolog (S. cerevisiae) | - | HPRD | 12379650 |
RAD9A | RAD9 | RAD9 homolog A (S. pombe) | - | HPRD,BioGRID | 11971963 |
RAN | ARA24 | Gsp1 | TC4 | RAN, member RAS oncogene family | - | HPRD,BioGRID | 11420673 |
RASA1 | CM-AVM | CMAVM | DKFZp434N071 | GAP | PKWS | RASA | RASGAP | p120GAP | p120RASGAP | RAS p21 protein activator (GTPase activating protein) 1 | c-Abl interacts with GAP. | BIND | 1383690 |
RB1 | OSRC | RB | p105-Rb | pRb | pp110 | retinoblastoma 1 | - | HPRD | 7828850 |8242749 |
RB1 | OSRC | RB | p105-Rb | pRb | pp110 | retinoblastoma 1 | Rb interacts with c-Abl | BIND | 9632788 |
RB1 | OSRC | RB | p105-Rb | pRb | pp110 | retinoblastoma 1 | - | HPRD,BioGRID | 8242749 |
RFX1 | EF-C | regulatory factor X, 1 (influences HLA class II expression) | - | HPRD,BioGRID | 9583676 |
RIN1 | - | Ras and Rab interactor 1 | ABL1 interacts with and phosphorylates RIN1. | BIND | 15886098 |
RIN1 | - | Ras and Rab interactor 1 | - | HPRD | 9144171 |
ROBO1 | DUTT1 | FLJ21882 | MGC131599 | MGC133277 | SAX3 | roundabout, axon guidance receptor, homolog 1 (Drosophila) | Robo1 interacts with Abl1. This interaction was modelled on a demonstrated interaction between Robo1 from human and Abl1 from Drosophila melanogaster. | BIND | 10892742 |
ROS1 | MCF3 | ROS | c-ros-1 | c-ros oncogene 1 , receptor tyrosine kinase | - | HPRD | 11266449 |
RYBP | AAP1 | DEDAF | YEAF1 | RING1 and YY1 binding protein | Far Western Reconstituted Complex Two-hybrid | BioGRID | 8943360 |
SH3BP1 | - | SH3-domain binding protein 1 | - | HPRD,BioGRID | 1379745 |
SH3BP2 | 3BP2 | CRBM | CRPM | FLJ42079 | RES4-23 | SH3-domain binding protein 2 | - | HPRD | 8438166 |
SHC1 | FLJ26504 | SHC | SHCA | SHC (Src homology 2 domain containing) transforming protein 1 | Affinity Capture-Western | BioGRID | 8112292 |10194451 |
SHD | - | Src homology 2 domain containing transforming protein D | - | HPRD,BioGRID | 9315092 |
SLC9A2 | NHE2 | solute carrier family 9 (sodium/hydrogen exchanger), member 2 | - | HPRD,BioGRID | 10187839 |
SORBS1 | CAP | DKFZp451C066 | DKFZp586P1422 | FLAF2 | FLJ12406 | KIAA1296 | R85FL | SH3D5 | SH3P12 | SORB1 | sorbin and SH3 domain containing 1 | - | HPRD,BioGRID | 11374898 |
SORBS2 | ARGBP2 | FLJ93447 | KIAA0777 | PRO0618 | sorbin and SH3 domain containing 2 | - | HPRD,BioGRID | 9211900 |12475393 |
SOS1 | GF1 | GGF1 | GINGF | HGF | NS4 | son of sevenless homolog 1 (Drosophila) | Affinity Capture-Western | BioGRID | 8112292 |
SPTA1 | EL2 | SPTA | spectrin, alpha, erythrocytic 1 (elliptocytosis 2) | Affinity Capture-Western Reconstituted Complex | BioGRID | 9593709 |
SPTAN1 | (ALPHA)II-SPECTRIN | FLJ44613 | NEAS | spectrin, alpha, non-erythrocytic 1 (alpha-fodrin) | Reconstituted Complex Two-hybrid | BioGRID | 9593709 |
SRC | ASV | SRC1 | c-SRC | p60-Src | v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian) | c-Abl interacts with Src. This interaction was modeled on a demonstrated interaction between human c-Abl and v-Src from the Rous Sarcoma virus. | BIND | 1383690 |
ST5 | DENND2B | HTS1 | MGC33090 | p126 | suppression of tumorigenicity 5 | - | HPRD,BioGRID | 9632734 |
TERF1 | FLJ41416 | PIN2 | TRBF1 | TRF | TRF1 | hTRF1-AS | t-TRF1 | telomeric repeat binding factor (NIMA-interacting) 1 | Affinity Capture-Western | BioGRID | 11375976 |
TP53 | FLJ92943 | LFS1 | TRP53 | p53 | tumor protein p53 | - | HPRD,BioGRID | 10629029 |10713716 |
TP73 | P73 | tumor protein p73 | - | HPRD,BioGRID | 10391250 |10391251 |
TUB | rd5 | tubby homolog (mouse) | - | HPRD,BioGRID | 10455176 |
VAV1 | VAV | vav 1 guanine nucleotide exchange factor | Affinity Capture-Western Biochemical Activity Reconstituted Complex Two-hybrid | BioGRID | 11790798 |
WASF1 | FLJ31482 | KIAA0269 | SCAR1 | WAVE | WAVE1 | WAS protein family, member 1 | WAVE-1 interacts with Abl. | BIND | 10970852 |
WASF1 | FLJ31482 | KIAA0269 | SCAR1 | WAVE | WAVE1 | WAS protein family, member 1 | - | HPRD | 10970852 |
XRCC6 | CTC75 | CTCBF | G22P1 | KU70 | ML8 | TLAA | X-ray repair complementing defective repair in Chinese hamster cells 6 | - | HPRD,BioGRID | 9798959 |
YTHDC1 | KIAA1966 | YT521 | YT521-B | YTH domain containing 1 | - | HPRD,BioGRID | 15175272 |
YWHAD | - | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, delta polypeptide | c-Abl interacts with 14-3-3-delta. | BIND | 15696159 |
YWHAH | YWHA1 | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide | c-Abl interacts with 14-3-3-eta. | BIND | 15696159 |
ZAP70 | FLJ17670 | FLJ17679 | SRK | STD | TZK | ZAP-70 | zeta-chain (TCR) associated protein kinase 70kDa | - | HPRD,BioGRID | 7760813 |
ZDHHC16 | APH2 | MGC2993 | zinc finger, DHHC-type containing 16 | - | HPRD,BioGRID | 12021275 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG ERBB SIGNALING PATHWAY | 87 | 71 | All SZGR 2.0 genes in this pathway |
KEGG CELL CYCLE | 128 | 84 | All SZGR 2.0 genes in this pathway |
KEGG AXON GUIDANCE | 129 | 103 | All SZGR 2.0 genes in this pathway |
KEGG NEUROTROPHIN SIGNALING PATHWAY | 126 | 103 | All SZGR 2.0 genes in this pathway |
KEGG PATHOGENIC ESCHERICHIA COLI INFECTION | 59 | 36 | All SZGR 2.0 genes in this pathway |
KEGG PATHWAYS IN CANCER | 328 | 259 | All SZGR 2.0 genes in this pathway |
KEGG CHRONIC MYELOID LEUKEMIA | 73 | 59 | All SZGR 2.0 genes in this pathway |
KEGG VIRAL MYOCARDITIS | 73 | 58 | All SZGR 2.0 genes in this pathway |
BIOCARTA ATM PATHWAY | 20 | 16 | All SZGR 2.0 genes in this pathway |
BIOCARTA G1 PATHWAY | 28 | 21 | All SZGR 2.0 genes in this pathway |
BIOCARTA ARF PATHWAY | 17 | 13 | All SZGR 2.0 genes in this pathway |
ST INTEGRIN SIGNALING PATHWAY | 82 | 62 | All SZGR 2.0 genes in this pathway |
PID P73PATHWAY | 79 | 59 | All SZGR 2.0 genes in this pathway |
PID ATM PATHWAY | 34 | 25 | All SZGR 2.0 genes in this pathway |
PID TELOMERASE PATHWAY | 68 | 48 | All SZGR 2.0 genes in this pathway |
PID AJDISS 2PATHWAY | 48 | 38 | All SZGR 2.0 genes in this pathway |
PID LIS1 PATHWAY | 28 | 22 | All SZGR 2.0 genes in this pathway |
PID PDGFRB PATHWAY | 129 | 103 | All SZGR 2.0 genes in this pathway |
PID TRKR PATHWAY | 62 | 48 | All SZGR 2.0 genes in this pathway |
PID TAP63 PATHWAY | 54 | 40 | All SZGR 2.0 genes in this pathway |
PID P53 REGULATION PATHWAY | 59 | 50 | All SZGR 2.0 genes in this pathway |
PID RB 1PATHWAY | 65 | 46 | All SZGR 2.0 genes in this pathway |
REACTOME DEVELOPMENTAL BIOLOGY | 396 | 292 | All SZGR 2.0 genes in this pathway |
REACTOME AXON GUIDANCE | 251 | 188 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY ROBO RECEPTOR | 30 | 26 | All SZGR 2.0 genes in this pathway |
REACTOME MYOGENESIS | 28 | 20 | All SZGR 2.0 genes in this pathway |
REACTOME FACTORS INVOLVED IN MEGAKARYOCYTE DEVELOPMENT AND PLATELET PRODUCTION | 132 | 101 | All SZGR 2.0 genes in this pathway |
REACTOME HEMOSTASIS | 466 | 331 | All SZGR 2.0 genes in this pathway |
HOLLMANN APOPTOSIS VIA CD40 DN | 267 | 178 | All SZGR 2.0 genes in this pathway |
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
KOKKINAKIS METHIONINE DEPRIVATION 48HR UP | 128 | 95 | All SZGR 2.0 genes in this pathway |
KOKKINAKIS METHIONINE DEPRIVATION 96HR UP | 117 | 84 | All SZGR 2.0 genes in this pathway |
ENK UV RESPONSE KERATINOCYTE UP | 530 | 342 | All SZGR 2.0 genes in this pathway |
LINDGREN BLADDER CANCER CLUSTER 2A UP | 8 | 5 | All SZGR 2.0 genes in this pathway |
GAUSSMANN MLL AF4 FUSION TARGETS G UP | 238 | 135 | All SZGR 2.0 genes in this pathway |
GALLUZZI PERMEABILIZE MITOCHONDRIA | 43 | 31 | All SZGR 2.0 genes in this pathway |
LINDGREN BLADDER CANCER WITH LOH IN CHR9Q | 116 | 71 | All SZGR 2.0 genes in this pathway |
MYLLYKANGAS AMPLIFICATION HOT SPOT 8 | 18 | 7 | All SZGR 2.0 genes in this pathway |
SCHLOSSER SERUM RESPONSE DN | 712 | 443 | All SZGR 2.0 genes in this pathway |
HEIDENBLAD AMPLICON 8Q24 UP | 40 | 23 | All SZGR 2.0 genes in this pathway |
PUJANA BREAST CANCER LIT INT NETWORK | 101 | 73 | All SZGR 2.0 genes in this pathway |
PUJANA ATM PCC NETWORK | 1442 | 892 | All SZGR 2.0 genes in this pathway |
COLLIS PRKDC SUBSTRATES | 20 | 15 | All SZGR 2.0 genes in this pathway |
COLLIS PRKDC REGULATORS | 15 | 10 | All SZGR 2.0 genes in this pathway |
KAUFFMANN DNA REPAIR GENES | 230 | 137 | All SZGR 2.0 genes in this pathway |
FLECHNER PBL KIDNEY TRANSPLANT OK VS DONOR DN | 41 | 30 | All SZGR 2.0 genes in this pathway |
ZHAN MULTIPLE MYELOMA UP | 64 | 46 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
YIH RESPONSE TO ARSENITE C2 | 18 | 15 | All SZGR 2.0 genes in this pathway |
ZHU CMV 24 HR DN | 91 | 64 | All SZGR 2.0 genes in this pathway |
ZHU CMV ALL DN | 128 | 93 | All SZGR 2.0 genes in this pathway |
DAZARD RESPONSE TO UV NHEK DN | 318 | 220 | All SZGR 2.0 genes in this pathway |
IVANOVA HEMATOPOIESIS STEM CELL AND PROGENITOR | 681 | 420 | All SZGR 2.0 genes in this pathway |
DAZARD UV RESPONSE CLUSTER G6 | 153 | 112 | All SZGR 2.0 genes in this pathway |
GRESHOCK CANCER COPY NUMBER UP | 323 | 240 | All SZGR 2.0 genes in this pathway |
HAN SATB1 TARGETS UP | 395 | 249 | All SZGR 2.0 genes in this pathway |
WONG ADULT TISSUE STEM MODULE | 721 | 492 | All SZGR 2.0 genes in this pathway |
NAKAMURA ADIPOGENESIS EARLY UP | 66 | 44 | All SZGR 2.0 genes in this pathway |
NAKAMURA ADIPOGENESIS LATE UP | 104 | 67 | All SZGR 2.0 genes in this pathway |
KOINUMA TARGETS OF SMAD2 OR SMAD3 | 824 | 528 | All SZGR 2.0 genes in this pathway |
PURBEY TARGETS OF CTBP1 NOT SATB1 UP | 344 | 215 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-203.1 | 1074 | 1080 | 1A | hsa-miR-203 | UGAAAUGUUUAGGACCACUAG |
miR-29 | 640 | 646 | 1A | hsa-miR-29aSZ | UAGCACCAUCUGAAAUCGGUU |
hsa-miR-29bSZ | UAGCACCAUUUGAAAUCAGUGUU | ||||
hsa-miR-29cSZ | UAGCACCAUUUGAAAUCGGU | ||||
miR-30-5p | 1979 | 1986 | 1A,m8 | hsa-miR-30a-5p | UGUAAACAUCCUCGACUGGAAG |
hsa-miR-30cbrain | UGUAAACAUCCUACACUCUCAGC | ||||
hsa-miR-30dSZ | UGUAAACAUCCCCGACUGGAAG | ||||
hsa-miR-30bSZ | UGUAAACAUCCUACACUCAGCU | ||||
hsa-miR-30e-5p | UGUAAACAUCCUUGACUGGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.