SZGR2

Summary ?

GeneID	25
Symbol	ABL1
Synonyms	ABL\|JTK7\|bcr/abl\|c-ABL\|c-ABL1\|p150\|v-abl
Description	ABL proto-oncogene 1, non-receptor tyrosine kinase
Reference	MIM:189980\|HGNC:HGNC:76\|Ensembl:ENSG00000097007\|HPRD:01809\|Vega:OTTHUMG00000020813
Gene type	protein-coding
Map location	9q34.1
Pascal p-value	0.23
Sherlock p-value	0.025
Fetal beta	1.012
Support	Ascano FMRP targets

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 1.1761

Section I. Genetics and epigenetics annotation

DNM table

Gene	Chromosome	Position	Ref	Alt	Transcript	AA change	Mutation type	Sift	CG46	Trait	Study
ABL1	chr9	133750294	C	T	NM_005157 NM_007313	. .	silent silent			Schizophrenia	DNM:Fromer_2014

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000166	nucleotide binding	IEA		-
GO:0000287	magnesium ion binding	IDA		9144171
GO:0004872	receptor activity	IEA		-
GO:0003674	molecular_function	ND		-
GO:0003677	DNA binding	NAS		8242749
GO:0005515	protein binding	IEA		-
GO:0005524	ATP binding	IDA		9144171
GO:0004715	non-membrane spanning protein tyrosine kinase activity	IEA		-
GO:0016740	transferase activity	IEA		-
GO:0008022	protein C-terminus binding	IPI		11971963
GO:0016301	kinase activity	IEA		-
GO:0030145	manganese ion binding	IDA		9144171
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000115	regulation of transcription during S-phase of mitotic cell cycle	TAS		8242749
GO:0006355	regulation of transcription, DNA-dependent	TAS		8242749
GO:0007155	cell adhesion	IEA		-
GO:0006298	mismatch repair	TAS		10391249
GO:0006464	protein modification process	NAS		8242749
GO:0008630	DNA damage response, signal transduction resulting in induction of apoptosis	TAS		10391249
GO:0008150	biological_process	ND		-
GO:0018108	peptidyl-tyrosine phosphorylation	IDA		9144171
GO:0030036	actin cytoskeleton organization	ISS		-
GO:0051353	positive regulation of oxidoreductase activity	IDA		12893824
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005856	cytoskeleton	IEA		-
GO:0005575	cellular_component	ND		-
GO:0005634	nucleus	NAS		8242749
GO:0005730	nucleolus	IDA		12944467
GO:0005737	cytoplasm	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ABI1	ABI-1 \| E3B1 \| NAP1BP \| SSH3BP \| SSH3BP1	abl-interactor 1	-	HPRD	9010225 \|12672821
ABI1	ABI-1 \| E3B1 \| NAP1BP \| SSH3BP \| SSH3BP1	abl-interactor 1	hNap1BP interacts with Abl.	BIND	11418237
ABI1	ABI-1 \| E3B1 \| NAP1BP \| SSH3BP \| SSH3BP1	abl-interactor 1	Affinity Capture-Western Reconstituted Complex	BioGRID	9010225 \|11418237 \|12672821
ABI2	ABI-2 \| ABI2B \| AIP-1 \| AblBP3 \| SSH3BP2 \| argBPIA \| argBPIB	abl interactor 2	-	HPRD,BioGRID	7590236
ABL1	ABL \| JTK7 \| bcr/abl \| c-ABL \| p150 \| v-abl	c-abl oncogene 1, receptor tyrosine kinase	Protein-peptide	BioGRID	12654250
ABL1	ABL \| JTK7 \| bcr/abl \| c-ABL \| p150 \| v-abl	c-abl oncogene 1, receptor tyrosine kinase	c-Abl 1b interacts with itself in trans via the SH2 domain.	BIND	1383690
ABL2	ABLL \| ARG \| FLJ22224 \| FLJ31718 \| FLJ41441	v-abl Abelson murine leukemia viral oncogene homolog 2 (arg, Abelson-related gene)	-	HPRD,BioGRID	12569093
ABL2	ABLL \| ARG \| FLJ22224 \| FLJ31718 \| FLJ41441	v-abl Abelson murine leukemia viral oncogene homolog 2 (arg, Abelson-related gene)	ABL1 (c-Abl) phosphorylates ABL2 (Arg).	BIND	15735735
ABL2	ABLL \| ARG \| FLJ22224 \| FLJ31718 \| FLJ41441	v-abl Abelson murine leukemia viral oncogene homolog 2 (arg, Abelson-related gene)	c-Abl interacts with ARG.	BIND	1383690
ADAM15	MDC15	ADAM metallopeptidase domain 15	-	HPRD	11741929
APBB1	FE65 \| MGC:9072 \| RIR	amyloid beta (A4) precursor protein-binding, family B, member 1 (Fe65)	-	HPRD	11279131
APP	AAA \| ABETA \| ABPP \| AD1 \| APPI \| CTFgamma \| CVAP \| PN2	amyloid beta (A4) precursor protein	-	HPRD	11279131
ARHGAP17	DKFZp564A1363 \| FLJ37567 \| FLJ43368 \| MGC87805 \| MST066 \| MST110 \| MSTP038 \| MSTP066 \| MSTP110 \| NADRIN \| RICH1 \| WBP15	Rho GTPase activating protein 17	Reconstituted Complex	BioGRID	11431473
ATM	AT1 \| ATA \| ATC \| ATD \| ATDC \| ATE \| DKFZp781A0353 \| MGC74674 \| TEL1 \| TELO1	ataxia telangiectasia mutated	-	HPRD,BioGRID	9168117
ATR	FRP1 \| MEC1 \| SCKL \| SCKL1	ataxia telangiectasia and Rad3 related	Protein-peptide	BioGRID	10608806
BCAR1	CAS \| CAS1 \| CASS1 \| CRKAS \| P130Cas	breast cancer anti-estrogen resistance 1	-	HPRD,BioGRID	7780740
BCR	ALL \| BCR-ABL1 \| BCR1 \| CML \| D22S11 \| D22S662 \| FLJ16453 \| PHL	breakpoint cluster region	BCR interacts with c-Abl. This interaction was modeled on a demonstrated interaction between BCR from an unspecified source and human c-Abl.	BIND	1383690
BCR	ALL \| BCR-ABL1 \| BCR1 \| CML \| D22S11 \| D22S662 \| FLJ16453 \| PHL	breakpoint cluster region	-	HPRD	11780146
BCR	ALL \| BCR-ABL1 \| BCR1 \| CML \| D22S11 \| D22S662 \| FLJ16453 \| PHL	breakpoint cluster region	Affinity Capture-Western Reconstituted Complex	BioGRID	1712671 \|8112292 \|12543778
BIN1	AMPH2 \| AMPHL \| DKFZp547F068 \| MGC10367 \| SH3P9	bridging integrator 1	-	HPRD	9356459
BRCA1	BRCAI \| BRCC1 \| IRIS \| PSCP \| RNF53	breast cancer 1, early onset	Affinity Capture-Western	BioGRID	12024016
C3	ARMD9 \| ASP \| CPAMD1	complement component 3	-	HPRD	4062888
CABLES2	C20orf150 \| dJ908M14.2 \| ik3-2	Cdk5 and Abl enzyme substrate 2	-	HPRD,BioGRID	11955625
CASP9	APAF-3 \| APAF3 \| CASPASE-9c \| ICE-LAP6 \| MCH6	caspase 9, apoptosis-related cysteine peptidase	-	HPRD	15657060
CAT	MGC138422 \| MGC138424	catalase	Affinity Capture-Western Biochemical Activity Reconstituted Complex	BioGRID	12777400
CBL	C-CBL \| CBL2 \| RNF55	Cas-Br-M (murine) ecotropic retroviral transforming sequence	-	HPRD,BioGRID	12475393
CREB1	CREB \| MGC9284	cAMP responsive element binding protein 1	Reconstituted Complex	BioGRID	7565761
CRK	CRKII	v-crk sarcoma virus CT10 oncogene homolog (avian)	c-Abl interacts with Crk. This interaction was modeled on a demonstrated interaction between human c-Abl and Crk from an unspecified species.	BIND	15696159
CRK	CRKII	v-crk sarcoma virus CT10 oncogene homolog (avian)	Interaction between ABL (PDB ID: 1JU5_C) and CRK (PDB ID: 1JU5_A).	BIND	12384576
CRKL	-	v-crk sarcoma virus CT10 oncogene homolog (avian)-like	Affinity Capture-Western Reconstituted Complex Two-hybrid	BioGRID	7926767 \|8083188 \|8978305 \|9820532
CRKL	-	v-crk sarcoma virus CT10 oncogene homolog (avian)-like	-	HPRD	7493940
CTNND2	GT24 \| NPRAP	catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)	-	HPRD	11891774
DOK1	MGC117395 \| MGC138860 \| P62DOK	docking protein 1, 62kDa (downstream of tyrosine kinase 1)	-	HPRD	10567556
DOK1	MGC117395 \| MGC138860 \| P62DOK	docking protein 1, 62kDa (downstream of tyrosine kinase 1)	Affinity Capture-Western Biochemical Activity Reconstituted Complex	BioGRID	9008161 \|11071635
DOK3	DOKL \| FLJ22570 \| FLJ39939	docking protein 3	-	HPRD	10567556
EPHB2	CAPB \| DRT \| EPHT3 \| ERK \| Hek5 \| MGC87492 \| PCBC \| Tyro5	EPH receptor B2	-	HPRD,BioGRID	11494128
EVL	RNB6	Enah/Vasp-like	-	HPRD,BioGRID	10945997
FRAP1	FLJ44809 \| FRAP \| FRAP2 \| MTOR \| RAFT1 \| RAPT1	FK506 binding protein 12-rapamycin associated protein 1	Affinity Capture-Western	BioGRID	10753870
GPX1	GSHPX1 \| MGC14399 \| MGC88245	glutathione peroxidase 1	-	HPRD,BioGRID	12893824
GRB10	GRB-IR \| Grb-10 \| IRBP \| KIAA0207 \| MEG1 \| RSS	growth factor receptor-bound protein 10	Affinity Capture-Western Reconstituted Complex	BioGRID	9006901 \|9747873
GRB2	ASH \| EGFRBP-GRB2 \| Grb3-3 \| MST084 \| MSTP084	growth factor receptor-bound protein 2	-	HPRD	9516488
GRB2	ASH \| EGFRBP-GRB2 \| Grb3-3 \| MST084 \| MSTP084	growth factor receptor-bound protein 2	Affinity Capture-Western	BioGRID	9407116
GRIN2D	EB11 \| NMDAR2D	glutamate receptor, ionotropic, N-methyl D-aspartate 2D	-	HPRD	10777567
HCK	JTK9	hemopoietic cell kinase	-	HPRD,BioGRID	9407116
INPPL1	SHIP2	inositol polyphosphate phosphatase-like 1	-	HPRD,BioGRID	10194451
JAK1	JAK1A \| JAK1B \| JTK3	Janus kinase 1 (a protein tyrosine kinase)	Reconstituted Complex	BioGRID	9774693
JAK1	JAK1A \| JAK1B \| JTK3	Janus kinase 1 (a protein tyrosine kinase)	-	HPRD	12130510
MAP4K5	GCKR \| KHS \| KHS1 \| MAPKKKK5	mitogen-activated protein kinase kinase kinase kinase 5	-	HPRD	9949177
MDM2	HDMX \| MGC71221 \| hdm2	Mdm2 p53 binding protein homolog (mouse)	-	HPRD,BioGRID	12110584
MICAL1	DKFZp434B1517 \| FLJ11937 \| FLJ21739 \| MICAL \| MICAL-1 \| NICAL	microtubule associated monoxygenase, calponin and LIM domain containing 1	Reconstituted Complex	BioGRID	11827972
NCF1C	SH3PXD1C	neutrophil cytosolic factor 1C pseudogene	c-Abl interacts with p47phox.	BIND	12681507
NCK1	MGC12668 \| NCK \| NCKalpha	NCK adaptor protein 1	-	HPRD,BioGRID	11494134
NCSTN	APH2 \| KIAA0253	nicastrin	-	HPRD	12021275
NEDD9	CAS-L \| CAS2 \| CASL \| CASS2 \| HEF1 \| dJ49G10.2 \| dJ761I2.1	neural precursor cell expressed, developmentally down-regulated 9	-	HPRD,BioGRID	8668148 \|8879209
NTRK1	DKFZp781I14186 \| MTC \| TRK \| TRK1 \| TRKA \| p140-TrkA	neurotrophic tyrosine kinase, receptor, type 1	-	HPRD,BioGRID	10679771 \|10708759
PAG1	CBP \| FLJ37858 \| MGC138364 \| PAG	phosphoprotein associated with glycosphingolipid microdomains 1	-	HPRD,BioGRID	9334312
PAK2	PAK65 \| PAKgamma	p21 protein (Cdc42/Rac)-activated kinase 2	-	HPRD,BioGRID	11121037
PDE4D	DPDE3 \| HSPDE4D \| PDE4DN2 \| STRK1	phosphodiesterase 4D, cAMP-specific (phosphodiesterase E3 dunce homolog, Drosophila)	PDE4D4 interacts with Abl. This interaction was modelled on a demonstrated interaction between human PDE4D4 and abl from an unspecified species.	BIND	10571082
PIK3R1	GRB1 \| p85 \| p85-ALPHA	phosphoinositide-3-kinase, regulatory subunit 1 (alpha)	c-Abl interacts with p85. This interaction was modeled on a demonstrated interaction between human c-Abl and bovine p85.	BIND	1383690
PIK3R1	GRB1 \| p85 \| p85-ALPHA	phosphoinositide-3-kinase, regulatory subunit 1 (alpha)	Reconstituted Complex	BioGRID	8294442
PLCG1	PLC-II \| PLC1 \| PLC148 \| PLCgamma1	phospholipase C, gamma 1	c-Abl interacts with PLC-gamma1. This interaction was modeled on a demonstrated interaction between human c-Abl and bovine PLCgamma1.	BIND	1383690
PLCG1	PLC-II \| PLC1 \| PLC148 \| PLCgamma1	phospholipase C, gamma 1	Reconstituted Complex	BioGRID	10708759
PLSCR1	MMTRA1B	phospholipid scramblase 1	-	HPRD	11390389
PRKDC	DNA-PKcs \| DNAPK \| DNPK1 \| HYRC \| HYRC1 \| XRCC7 \| p350	protein kinase, DNA-activated, catalytic polypeptide	-	HPRD,BioGRID	9312071
PSTPIP1	CD2BP1 \| CD2BP1L \| CD2BP1S \| H-PIP \| PAPAS \| PSTPIP	proline-serine-threonine phosphatase interacting protein 1	-	HPRD,BioGRID	11163214
PTPN6	HCP \| HCPH \| HPTP1C \| PTP-1C \| SH-PTP1 \| SHP-1 \| SHP-1L \| SHP1	protein tyrosine phosphatase, non-receptor type 6	Affinity Capture-Western	BioGRID	8692915
PXN	FLJ16691	paxillin	-	HPRD	9603926
RAD51	BRCC5 \| HRAD51 \| HsRad51 \| HsT16930 \| RAD51A \| RECA	RAD51 homolog (RecA homolog, E. coli) (S. cerevisiae)	Affinity Capture-Western Reconstituted Complex	BioGRID	10212258
RAD52	-	RAD52 homolog (S. cerevisiae)	-	HPRD	12379650
RAD9A	RAD9	RAD9 homolog A (S. pombe)	-	HPRD,BioGRID	11971963
RAN	ARA24 \| Gsp1 \| TC4	RAN, member RAS oncogene family	-	HPRD,BioGRID	11420673
RASA1	CM-AVM \| CMAVM \| DKFZp434N071 \| GAP \| PKWS \| RASA \| RASGAP \| p120GAP \| p120RASGAP	RAS p21 protein activator (GTPase activating protein) 1	c-Abl interacts with GAP.	BIND	1383690
RB1	OSRC \| RB \| p105-Rb \| pRb \| pp110	retinoblastoma 1	-	HPRD	7828850 \|8242749
RB1	OSRC \| RB \| p105-Rb \| pRb \| pp110	retinoblastoma 1	Rb interacts with c-Abl	BIND	9632788
RB1	OSRC \| RB \| p105-Rb \| pRb \| pp110	retinoblastoma 1	-	HPRD,BioGRID	8242749
RFX1	EF-C	regulatory factor X, 1 (influences HLA class II expression)	-	HPRD,BioGRID	9583676
RIN1	-	Ras and Rab interactor 1	ABL1 interacts with and phosphorylates RIN1.	BIND	15886098
RIN1	-	Ras and Rab interactor 1	-	HPRD	9144171
ROBO1	DUTT1 \| FLJ21882 \| MGC131599 \| MGC133277 \| SAX3	roundabout, axon guidance receptor, homolog 1 (Drosophila)	Robo1 interacts with Abl1. This interaction was modelled on a demonstrated interaction between Robo1 from human and Abl1 from Drosophila melanogaster.	BIND	10892742
ROS1	MCF3 \| ROS \| c-ros-1	c-ros oncogene 1 , receptor tyrosine kinase	-	HPRD	11266449
RYBP	AAP1 \| DEDAF \| YEAF1	RING1 and YY1 binding protein	Far Western Reconstituted Complex Two-hybrid	BioGRID	8943360
SH3BP1	-	SH3-domain binding protein 1	-	HPRD,BioGRID	1379745
SH3BP2	3BP2 \| CRBM \| CRPM \| FLJ42079 \| RES4-23	SH3-domain binding protein 2	-	HPRD	8438166
SHC1	FLJ26504 \| SHC \| SHCA	SHC (Src homology 2 domain containing) transforming protein 1	Affinity Capture-Western	BioGRID	8112292 \|10194451
SHD	-	Src homology 2 domain containing transforming protein D	-	HPRD,BioGRID	9315092
SLC9A2	NHE2	solute carrier family 9 (sodium/hydrogen exchanger), member 2	-	HPRD,BioGRID	10187839
SORBS1	CAP \| DKFZp451C066 \| DKFZp586P1422 \| FLAF2 \| FLJ12406 \| KIAA1296 \| R85FL \| SH3D5 \| SH3P12 \| SORB1	sorbin and SH3 domain containing 1	-	HPRD,BioGRID	11374898
SORBS2	ARGBP2 \| FLJ93447 \| KIAA0777 \| PRO0618	sorbin and SH3 domain containing 2	-	HPRD,BioGRID	9211900 \|12475393
SOS1	GF1 \| GGF1 \| GINGF \| HGF \| NS4	son of sevenless homolog 1 (Drosophila)	Affinity Capture-Western	BioGRID	8112292
SPTA1	EL2 \| SPTA	spectrin, alpha, erythrocytic 1 (elliptocytosis 2)	Affinity Capture-Western Reconstituted Complex	BioGRID	9593709
SPTAN1	(ALPHA)II-SPECTRIN \| FLJ44613 \| NEAS	spectrin, alpha, non-erythrocytic 1 (alpha-fodrin)	Reconstituted Complex Two-hybrid	BioGRID	9593709
SRC	ASV \| SRC1 \| c-SRC \| p60-Src	v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian)	c-Abl interacts with Src. This interaction was modeled on a demonstrated interaction between human c-Abl and v-Src from the Rous Sarcoma virus.	BIND	1383690
ST5	DENND2B \| HTS1 \| MGC33090 \| p126	suppression of tumorigenicity 5	-	HPRD,BioGRID	9632734
TERF1	FLJ41416 \| PIN2 \| TRBF1 \| TRF \| TRF1 \| hTRF1-AS \| t-TRF1	telomeric repeat binding factor (NIMA-interacting) 1	Affinity Capture-Western	BioGRID	11375976
TP53	FLJ92943 \| LFS1 \| TRP53 \| p53	tumor protein p53	-	HPRD,BioGRID	10629029 \|10713716
TP73	P73	tumor protein p73	-	HPRD,BioGRID	10391250 \|10391251
TUB	rd5	tubby homolog (mouse)	-	HPRD,BioGRID	10455176
VAV1	VAV	vav 1 guanine nucleotide exchange factor	Affinity Capture-Western Biochemical Activity Reconstituted Complex Two-hybrid	BioGRID	11790798
WASF1	FLJ31482 \| KIAA0269 \| SCAR1 \| WAVE \| WAVE1	WAS protein family, member 1	WAVE-1 interacts with Abl.	BIND	10970852
WASF1	FLJ31482 \| KIAA0269 \| SCAR1 \| WAVE \| WAVE1	WAS protein family, member 1	-	HPRD	10970852
XRCC6	CTC75 \| CTCBF \| G22P1 \| KU70 \| ML8 \| TLAA	X-ray repair complementing defective repair in Chinese hamster cells 6	-	HPRD,BioGRID	9798959
YTHDC1	KIAA1966 \| YT521 \| YT521-B	YTH domain containing 1	-	HPRD,BioGRID	15175272
YWHAD	-	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, delta polypeptide	c-Abl interacts with 14-3-3-delta.	BIND	15696159
YWHAH	YWHA1	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide	c-Abl interacts with 14-3-3-eta.	BIND	15696159
ZAP70	FLJ17670 \| FLJ17679 \| SRK \| STD \| TZK \| ZAP-70	zeta-chain (TCR) associated protein kinase 70kDa	-	HPRD,BioGRID	7760813
ZDHHC16	APH2 \| MGC2993	zinc finger, DHHC-type containing 16	-	HPRD,BioGRID	12021275

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG ERBB SIGNALING PATHWAY	87	71	All SZGR 2.0 genes in this pathway
KEGG CELL CYCLE	128	84	All SZGR 2.0 genes in this pathway
KEGG AXON GUIDANCE	129	103	All SZGR 2.0 genes in this pathway
KEGG NEUROTROPHIN SIGNALING PATHWAY	126	103	All SZGR 2.0 genes in this pathway
KEGG PATHOGENIC ESCHERICHIA COLI INFECTION	59	36	All SZGR 2.0 genes in this pathway
KEGG PATHWAYS IN CANCER	328	259	All SZGR 2.0 genes in this pathway
KEGG CHRONIC MYELOID LEUKEMIA	73	59	All SZGR 2.0 genes in this pathway
KEGG VIRAL MYOCARDITIS	73	58	All SZGR 2.0 genes in this pathway
BIOCARTA ATM PATHWAY	20	16	All SZGR 2.0 genes in this pathway
BIOCARTA G1 PATHWAY	28	21	All SZGR 2.0 genes in this pathway
BIOCARTA ARF PATHWAY	17	13	All SZGR 2.0 genes in this pathway
ST INTEGRIN SIGNALING PATHWAY	82	62	All SZGR 2.0 genes in this pathway
PID P73PATHWAY	79	59	All SZGR 2.0 genes in this pathway
PID ATM PATHWAY	34	25	All SZGR 2.0 genes in this pathway
PID TELOMERASE PATHWAY	68	48	All SZGR 2.0 genes in this pathway
PID AJDISS 2PATHWAY	48	38	All SZGR 2.0 genes in this pathway
PID LIS1 PATHWAY	28	22	All SZGR 2.0 genes in this pathway
PID PDGFRB PATHWAY	129	103	All SZGR 2.0 genes in this pathway
PID TRKR PATHWAY	62	48	All SZGR 2.0 genes in this pathway
PID TAP63 PATHWAY	54	40	All SZGR 2.0 genes in this pathway
PID P53 REGULATION PATHWAY	59	50	All SZGR 2.0 genes in this pathway
PID RB 1PATHWAY	65	46	All SZGR 2.0 genes in this pathway
REACTOME DEVELOPMENTAL BIOLOGY	396	292	All SZGR 2.0 genes in this pathway
REACTOME AXON GUIDANCE	251	188	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY ROBO RECEPTOR	30	26	All SZGR 2.0 genes in this pathway
REACTOME MYOGENESIS	28	20	All SZGR 2.0 genes in this pathway
REACTOME FACTORS INVOLVED IN MEGAKARYOCYTE DEVELOPMENT AND PLATELET PRODUCTION	132	101	All SZGR 2.0 genes in this pathway
REACTOME HEMOSTASIS	466	331	All SZGR 2.0 genes in this pathway
HOLLMANN APOPTOSIS VIA CD40 DN	267	178	All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP	1382	904	All SZGR 2.0 genes in this pathway
KOKKINAKIS METHIONINE DEPRIVATION 48HR UP	128	95	All SZGR 2.0 genes in this pathway
KOKKINAKIS METHIONINE DEPRIVATION 96HR UP	117	84	All SZGR 2.0 genes in this pathway
ENK UV RESPONSE KERATINOCYTE UP	530	342	All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 2A UP	8	5	All SZGR 2.0 genes in this pathway
GAUSSMANN MLL AF4 FUSION TARGETS G UP	238	135	All SZGR 2.0 genes in this pathway
GALLUZZI PERMEABILIZE MITOCHONDRIA	43	31	All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER WITH LOH IN CHR9Q	116	71	All SZGR 2.0 genes in this pathway
MYLLYKANGAS AMPLIFICATION HOT SPOT 8	18	7	All SZGR 2.0 genes in this pathway
SCHLOSSER SERUM RESPONSE DN	712	443	All SZGR 2.0 genes in this pathway
HEIDENBLAD AMPLICON 8Q24 UP	40	23	All SZGR 2.0 genes in this pathway
PUJANA BREAST CANCER LIT INT NETWORK	101	73	All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK	1442	892	All SZGR 2.0 genes in this pathway
COLLIS PRKDC SUBSTRATES	20	15	All SZGR 2.0 genes in this pathway
COLLIS PRKDC REGULATORS	15	10	All SZGR 2.0 genes in this pathway
KAUFFMANN DNA REPAIR GENES	230	137	All SZGR 2.0 genes in this pathway
FLECHNER PBL KIDNEY TRANSPLANT OK VS DONOR DN	41	30	All SZGR 2.0 genes in this pathway
ZHAN MULTIPLE MYELOMA UP	64	46	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP	1691	1088	All SZGR 2.0 genes in this pathway
YIH RESPONSE TO ARSENITE C2	18	15	All SZGR 2.0 genes in this pathway
ZHU CMV 24 HR DN	91	64	All SZGR 2.0 genes in this pathway
ZHU CMV ALL DN	128	93	All SZGR 2.0 genes in this pathway
DAZARD RESPONSE TO UV NHEK DN	318	220	All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS STEM CELL AND PROGENITOR	681	420	All SZGR 2.0 genes in this pathway
DAZARD UV RESPONSE CLUSTER G6	153	112	All SZGR 2.0 genes in this pathway
GRESHOCK CANCER COPY NUMBER UP	323	240	All SZGR 2.0 genes in this pathway
HAN SATB1 TARGETS UP	395	249	All SZGR 2.0 genes in this pathway
WONG ADULT TISSUE STEM MODULE	721	492	All SZGR 2.0 genes in this pathway
NAKAMURA ADIPOGENESIS EARLY UP	66	44	All SZGR 2.0 genes in this pathway
NAKAMURA ADIPOGENESIS LATE UP	104	67	All SZGR 2.0 genes in this pathway
KOINUMA TARGETS OF SMAD2 OR SMAD3	824	528	All SZGR 2.0 genes in this pathway
PURBEY TARGETS OF CTBP1 NOT SATB1 UP	344	215	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-203.1	1074	1080	1A	hsa-miR-203	UGAAAUGUUUAGGACCACUAG
miR-29	640	646	1A	hsa-miR-29a^SZ	UAGCACCAUCUGAAAUCGGUU
				hsa-miR-29b^SZ	UAGCACCAUUUGAAAUCAGUGUU
				hsa-miR-29c^SZ	UAGCACCAUUUGAAAUCGGU
miR-30-5p	1979	1986	1A,m8	hsa-miR-30a-5p	UGUAAACAUCCUCGACUGGAAG
				hsa-miR-30c^brain	UGUAAACAUCCUACACUCUCAGC
				hsa-miR-30d^SZ	UGUAAACAUCCCCGACUGGAAG
				hsa-miR-30b^SZ	UGUAAACAUCCUACACUCAGCU
				hsa-miR-30e-5p	UGUAAACAUCCUUGACUGGA

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: ABL1