SZGR2

Summary ?

GeneID	25843
Symbol	MOB4
Synonyms	2C4D\|CGI-95\|MOB1\|MOB3\|MOBKL3\|PHOCN\|PREI3
Description	MOB family member 4, phocein
Reference	MIM:609361\|HGNC:HGNC:17261\|Ensembl:ENSG00000115540\|HPRD:10165\|Vega:OTTHUMG00000132748
Gene type	protein-coding
Map location	2q33.1
Pascal p-value	9.062E-11
Sherlock p-value	0.125

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS

Section I. Genetics and epigenetics annotation

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
ZNF324B	0.90	0.91
EIF2B5	0.89	0.89
TRIM3	0.88	0.90
ZFYVE27	0.88	0.90
STRADA	0.87	0.88
ACAD8	0.87	0.89
SMYD5	0.87	0.88
ATG4B	0.87	0.88
ERCC3	0.87	0.88
COPS7B	0.86	0.87

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AF347015.31	-0.76	-0.77
MT-CO2	-0.76	-0.78
AF347015.8	-0.75	-0.78
AF347015.33	-0.75	-0.75
AF347015.27	-0.74	-0.77
MT-CYB	-0.74	-0.75
AF347015.21	-0.73	-0.82
AF347015.15	-0.72	-0.74
AF347015.2	-0.72	-0.74
AF347015.26	-0.71	-0.75

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005515	protein binding	IEA		-
GO:0005515	protein binding	IPI		17353931
GO:0008270	zinc ion binding	IEA		-
GO:0046872	metal ion binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006810	transport	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005794	Golgi apparatus	IEA		-
GO:0005737	cytoplasm	IEA		-
GO:0016020	membrane	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ARHGEF15	ARGEF15 \| FLJ13791 \| KIAA0915 \| MGC44868 \| Vsm-RhoGEF	Rho guanine nucleotide exchange factor (GEF) 15	Two-hybrid	BioGRID	16189514
C1orf103	FLJ11269 \| RIF1 \| RP11-96K19.1	chromosome 1 open reading frame 103	Two-hybrid	BioGRID	16169070
CAB39	CGI-66 \| FLJ22682 \| MO25	calcium binding protein 39	Affinity Capture-MS	BioGRID	17353931
CCDC59	BR22 \| DKFZp686K1021 \| FLJ10294 \| HSPC128 \| TAP26	coiled-coil domain containing 59	Affinity Capture-MS	BioGRID	17353931
CCDC85B	DIPA	coiled-coil domain containing 85B	Two-hybrid	BioGRID	16189514
CCT2	99D8.1 \| CCT-beta \| CCTB \| MGC142074 \| MGC142076 \| PRO1633 \| TCP-1-beta	chaperonin containing TCP1, subunit 2 (beta)	Affinity Capture-MS	BioGRID	18782753
CCT3	CCT-gamma \| CCTG \| PIG48 \| TCP-1-gamma \| TRIC5	chaperonin containing TCP1, subunit 3 (gamma)	Affinity Capture-MS	BioGRID	18782753
CCT5	CCT-epsilon \| CCTE \| KIAA0098 \| TCP-1-epsilon	chaperonin containing TCP1, subunit 5 (epsilon)	Affinity Capture-MS	BioGRID	18782753
CCT6A	CCT-zeta \| CCT-zeta-1 \| CCT6 \| Cctz \| HTR3 \| MGC126214 \| MGC126215 \| MoDP-2 \| TCP-1-zeta \| TCP20 \| TCPZ \| TTCP20	chaperonin containing TCP1, subunit 6A (zeta 1)	Affinity Capture-MS	BioGRID	18782753
CCT7	CCT-ETA \| Ccth \| MGC110985 \| Nip7-1 \| TCP-1-eta	chaperonin containing TCP1, subunit 7 (eta)	Affinity Capture-MS	BioGRID	18782753
CCT8	C21orf112 \| Cctq \| D21S246 \| KIAA0002 \| PRED71	chaperonin containing TCP1, subunit 8 (theta)	Affinity Capture-MS	BioGRID	18782753
CRMP1	DPYSL1 \| DRP-1 \| DRP1	collapsin response mediator protein 1	Two-hybrid	BioGRID	16169070
CTTNBP2	C7orf8 \| CORTBP2 \| FLJ34229 \| KIAA1758 \| MGC104579 \| Orf4	cortactin binding protein 2	Affinity Capture-MS	BioGRID	18782753
CTTNBP2NL	DKFZp547A023 \| FLJ13278	CTTNBP2 N-terminal like	Affinity Capture-MS Affinity Capture-Western	BioGRID	18782753
DNM1	DNM	dynamin 1	-	HPRD	11872741
FADD	GIG3 \| MGC8528 \| MORT1	Fas (TNFRSF6)-associated via death domain	Two-hybrid	BioGRID	16169070
FAM40A	FLJ14743 \| KIAA1761 \| MGC148091 \| RP4-773N10.1	family with sequence similarity 40, member A	Affinity Capture-MS	BioGRID	18782753
FAM40B	-	family with sequence similarity 40, member B	Affinity Capture-MS	BioGRID	18782753
FGFR1OP2	DKFZp564O1863 \| HSPC123-like	FGFR1 oncogene partner 2	Affinity Capture-MS	BioGRID	18782753
GDF9	-	growth differentiation factor 9	Two-hybrid	BioGRID	16169070
KIDINS220	ARMS \| MGC163482	kinase D-interacting substrate, 220kDa	Two-hybrid	BioGRID	16169070
MCM2	BM28 \| CCNL1 \| CDCL1 \| D3S3194 \| KIAA0030 \| MGC10606 \| MITOTIN \| cdc19	minichromosome maintenance complex component 2	Two-hybrid	BioGRID	16169070
MED10	L6 \| MGC5309 \| NUT2 \| TRG20	mediator complex subunit 10	Two-hybrid	BioGRID	16169070
MED31	3110004H13Rik \| CGI-125 \| FLJ27436 \| FLJ36714 \| Soh1	mediator complex subunit 31	Two-hybrid	BioGRID	16169070
MYL6	ESMLC \| LC17-GI \| LC17-NM \| LC17A \| LC17B \| MLC1SM \| MLC3NM \| MLC3SM	myosin, light chain 6, alkali, smooth muscle and non-muscle	Two-hybrid	BioGRID	16169070
NME2	MGC111212 \| NDPK-B \| NDPKB \| NM23-H2 \| NM23B \| puf	non-metastatic cells 2, protein (NM23B) expressed in	-	HPRD	11872741
PAICS	ADE2 \| ADE2H1 \| AIRC \| DKFZp781N1372 \| MGC1343 \| MGC5024 \| PAIS	phosphoribosylaminoimidazole carboxylase, phosphoribosylaminoimidazole succinocarboxamide synthetase	Two-hybrid	BioGRID	16169070
PDCD10	CCM3 \| MGC1212 \| MGC24477 \| TFAR15	programmed cell death 10	Affinity Capture-MS	BioGRID	18782753
PLEKHM1	AP162 \| B2 \| KIAA0356 \| OPTB6	pleckstrin homology domain containing, family M (with RUN domain) member 1	Two-hybrid	BioGRID	16169070
PPP2CA	PP2Ac \| PP2CA \| RP-C	protein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoform	Affinity Capture-MS	BioGRID	18782753
PPP2CB	PP2CB	protein phosphatase 2 (formerly 2A), catalytic subunit, beta isoform	Affinity Capture-MS	BioGRID	18782753
PPP2R1A	MGC786 \| PR65A	protein phosphatase 2 (formerly 2A), regulatory subunit A, alpha isoform	Affinity Capture-MS	BioGRID	18782753
PPP2R1B	MGC26454 \| PR65B	protein phosphatase 2 (formerly 2A), regulatory subunit A, beta isoform	Affinity Capture-MS	BioGRID	18782753
PTPRS	PTPSIGMA	protein tyrosine phosphatase, receptor type, S	Two-hybrid	BioGRID	16169070
RB1CC1	CC1 \| DRAGOU14 \| FIP200	RB1-inducible coiled-coil 1	Affinity Capture-MS	BioGRID	17353931
RP5-1000E10.4	DKFZp686A0768 \| FLJ21168 \| SIKE	suppressor of IKK epsilon	Affinity Capture-MS	BioGRID	18782753
RP6-213H19.1	MASK \| MST4	serine/threonine protein kinase MST4	Affinity Capture-MS	BioGRID	18782753
SCMH1	Scml3	sex comb on midleg homolog 1 (Drosophila)	Two-hybrid	BioGRID	16169070
SETDB1	ESET \| KG1T \| KIAA0067 \| KMT1E	SET domain, bifurcated 1	Two-hybrid	BioGRID	16169070
SLMAP	FLJ42206 \| KIAA1601 \| MGC138760 \| MGC138761 \| SLAP	sarcolemma associated protein	Affinity Capture-MS	BioGRID	18782753
STK24	MST-3 \| MST3 \| MST3B \| STE20 \| STK3	serine/threonine kinase 24 (STE20 homolog, yeast)	Affinity Capture-MS	BioGRID	17353931 \|18782753
STK25	DKFZp686J1430 \| SOK1 \| YSK1	serine/threonine kinase 25 (STE20 homolog, yeast)	Affinity Capture-MS	BioGRID	18782753
STRN	MGC125642 \| SG2NA	striatin, calmodulin binding protein	Affinity Capture-MS Affinity Capture-Western	BioGRID	18782753
STRN3	SG2NA	striatin, calmodulin binding protein 3	Affinity Capture-MS	BioGRID	18782753
STRN4	FLJ35594 \| ZIN \| zinedin	striatin, calmodulin binding protein 4	Affinity Capture-MS	BioGRID	18782753
TCP1	CCT-alpha \| CCT1 \| CCTa \| D6S230E \| TCP-1-alpha	t-complex 1	Affinity Capture-MS	BioGRID	18782753
TIMM13	TIM13 \| TIM13B \| TIMM13A \| TIMM13B \| ppv1	translocase of inner mitochondrial membrane 13 homolog (yeast)	Affinity Capture-MS	BioGRID	17353931
TRAF3IP3	DJ434O14.3 \| FLJ44151 \| MGC117354 \| MGC163289 \| T3JAM	TRAF3 interacting protein 3	Affinity Capture-MS Affinity Capture-Western	BioGRID	18782753
UBE2V2	DDVIT1 \| DDVit-1 \| EDAF-1 \| EDPF-1 \| EDPF1 \| MMS2 \| UEV-2 \| UEV2	ubiquitin-conjugating enzyme E2 variant 2	Two-hybrid	BioGRID	16169070
VHL	HRCA1 \| RCA1 \| VHL1	von Hippel-Lindau tumor suppressor	Affinity Capture-MS	BioGRID	17353931

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
PUIFFE INVASION INHIBITED BY ASCITES DN	145	91	All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA ANAPLASTIC UP	722	443	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN	855	609	All SZGR 2.0 genes in this pathway
WEI MYCN TARGETS WITH E BOX	795	478	All SZGR 2.0 genes in this pathway
SHEN SMARCA2 TARGETS UP	424	268	All SZGR 2.0 genes in this pathway
DEBIASI APOPTOSIS BY REOVIRUS INFECTION UP	314	201	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE DN	1237	837	All SZGR 2.0 genes in this pathway
MITSIADES RESPONSE TO APLIDIN UP	439	257	All SZGR 2.0 genes in this pathway
ZHANG BREAST CANCER PROGENITORS UP	425	253	All SZGR 2.0 genes in this pathway
BONCI TARGETS OF MIR15A AND MIR16 1	91	75	All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA HAPTOTAXIS UP	518	299	All SZGR 2.0 genes in this pathway
KIM BIPOLAR DISORDER OLIGODENDROCYTE DENSITY CORR UP	682	440	All SZGR 2.0 genes in this pathway
KIM ALL DISORDERS CALB1 CORR UP	548	370	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN	1972	1213	All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE EARLY LATE	317	190	All SZGR 2.0 genes in this pathway
FEVR CTNNB1 TARGETS UP	682	433	All SZGR 2.0 genes in this pathway
KOINUMA TARGETS OF SMAD2 OR SMAD3	824	528	All SZGR 2.0 genes in this pathway
FORTSCHEGGER PHF8 TARGETS DN	784	464	All SZGR 2.0 genes in this pathway
RAO BOUND BY SALL4	227	149	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
let-7/98	822	828	1A	hsa-let-7a^brain	UGAGGUAGUAGGUUGUAUAGUU
				hsa-let-7b^brain	UGAGGUAGUAGGUUGUGUGGUU
				hsa-let-7c^brain	UGAGGUAGUAGGUUGUAUGGUU
				hsa-let-7d^brain	AGAGGUAGUAGGUUGCAUAGU
				hsa-let-7e^brain	UGAGGUAGGAGGUUGUAUAGU
				hsa-let-7f^brain	UGAGGUAGUAGAUUGUAUAGUU
				hsa-miR-98^brain	UGAGGUAGUAAGUUGUAUUGUU
				hsa-let-7g^SZ	UGAGGUAGUAGUUUGUACAGU
				hsa-let-7i^brain	UGAGGUAGUAGUUUGUGCUGU
miR-101	45	52	1A,m8	hsa-miR-101	UACAGUACUGUGAUAACUGAAG
miR-142-3p	845	852	1A,m8	hsa-miR-142-3p	UGUAGUGUUUCCUACUUUAUGGA
miR-144	46	52	1A	hsa-miR-144	UACAGUAUAGAUGAUGUACUAG
miR-15/16/195/424/497	269	276	1A,m8	hsa-miR-15a^brain	UAGCAGCACAUAAUGGUUUGUG
				hsa-miR-16^brain	UAGCAGCACGUAAAUAUUGGCG
				hsa-miR-15b^brain	UAGCAGCACAUCAUGGUUUACA
				hsa-miR-195^SZ	UAGCAGCACAGAAAUAUUGGC
				hsa-miR-424	CAGCAGCAAUUCAUGUUUUGAA
				hsa-miR-497	CAGCAGCACACUGUGGUUUGU
miR-200bc/429	215	221	1A	hsa-miR-200b	UAAUACUGCCUGGUAAUGAUGAC
				hsa-miR-200c	UAAUACUGCCGGGUAAUGAUGG
				hsa-miR-429	UAAUACUGUCUGGUAAAACCGU
miR-219	278	284	1A	hsa-miR-219^brain	UGAUUGUCCAAACGCAAUUCU
miR-369-3p	86	92	1A	hsa-miR-369-3p	AAUAAUACAUGGUUGAUCUUU
miR-369-3p	86	92	1A	hsa-miR-369-3p	AAUAAUACAUGGUUGAUCUUU
miR-374	86	92	m8	hsa-miR-374	UUAUAAUACAACCUGAUAAGUG
miR-383	23	29	1A	hsa-miR-383^brain	AGAUCAGAAGGUGAUUGUGGCU
miR-503	270	276	1A	hsa-miR-503	UAGCAGCGGGAACAGUUCUGCAG

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: MOB4