Gene Page: GFRA1
Summary ?
| GeneID | 2674 |
| Symbol | GFRA1 |
| Synonyms | GDNFR|GDNFRA|GFR-ALPHA-1|RET1L|RETL1|TRNR1 |
| Description | GDNF family receptor alpha 1 |
| Reference | MIM:601496|HGNC:HGNC:4243|Ensembl:ENSG00000151892|HPRD:03291|Vega:OTTHUMG00000019097 |
| Gene type | protein-coding |
| Map location | 10q26.11 |
| Pascal p-value | 0.886 |
| Fetal beta | -0.074 |
| eGene | Anterior cingulate cortex BA24 Caudate basal ganglia Cortex Putamen basal ganglia |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 2 |
Section I. Genetics and epigenetics annotation
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs2420245 | 10 | 117935335 | GFRA1 | ENSG00000151892.10 | 7.316E-6 | 0.05 | 97644 | gtex_brain_ba24 |
| rs12267789 | 10 | 117922322 | GFRA1 | ENSG00000151892.10 | 2.354E-6 | 0 | 110657 | gtex_brain_putamen_basal |
| rs4751955 | 10 | 117923225 | GFRA1 | ENSG00000151892.10 | 7.777E-7 | 0 | 109754 | gtex_brain_putamen_basal |
| rs10749190 | 10 | 117923874 | GFRA1 | ENSG00000151892.10 | 6.622E-7 | 0 | 109105 | gtex_brain_putamen_basal |
| rs10749191 | 10 | 117924012 | GFRA1 | ENSG00000151892.10 | 4.737E-7 | 0 | 108967 | gtex_brain_putamen_basal |
| rs4553287 | 10 | 117924062 | GFRA1 | ENSG00000151892.10 | 7.771E-7 | 0 | 108917 | gtex_brain_putamen_basal |
| rs7096448 | 10 | 117924565 | GFRA1 | ENSG00000151892.10 | 6.622E-7 | 0 | 108414 | gtex_brain_putamen_basal |
| rs7078730 | 10 | 117924598 | GFRA1 | ENSG00000151892.10 | 6.622E-7 | 0 | 108381 | gtex_brain_putamen_basal |
| rs7904057 | 10 | 117925132 | GFRA1 | ENSG00000151892.10 | 6.622E-7 | 0 | 107847 | gtex_brain_putamen_basal |
| rs11197563 | 10 | 117926218 | GFRA1 | ENSG00000151892.10 | 2.411E-7 | 0 | 106761 | gtex_brain_putamen_basal |
| rs2270181 | 10 | 117928218 | GFRA1 | ENSG00000151892.10 | 3.564E-6 | 0 | 104761 | gtex_brain_putamen_basal |
| rs10749194 | 10 | 117929704 | GFRA1 | ENSG00000151892.10 | 2.385E-8 | 0 | 103275 | gtex_brain_putamen_basal |
| rs3781536 | 10 | 117930678 | GFRA1 | ENSG00000151892.10 | 2.427E-7 | 0 | 102301 | gtex_brain_putamen_basal |
| rs3781537 | 10 | 117930769 | GFRA1 | ENSG00000151892.10 | 2.409E-7 | 0 | 102210 | gtex_brain_putamen_basal |
| rs3781538 | 10 | 117931031 | GFRA1 | ENSG00000151892.10 | 2.411E-7 | 0 | 101948 | gtex_brain_putamen_basal |
| rs7087059 | 10 | 117931699 | GFRA1 | ENSG00000151892.10 | 2.411E-7 | 0 | 101280 | gtex_brain_putamen_basal |
| rs10787632 | 10 | 117931862 | GFRA1 | ENSG00000151892.10 | 3.564E-6 | 0 | 101117 | gtex_brain_putamen_basal |
| rs10749195 | 10 | 117932179 | GFRA1 | ENSG00000151892.10 | 2.411E-7 | 0 | 100800 | gtex_brain_putamen_basal |
| rs10749196 | 10 | 117933073 | GFRA1 | ENSG00000151892.10 | 2.976E-7 | 0 | 99906 | gtex_brain_putamen_basal |
| rs10749197 | 10 | 117933097 | GFRA1 | ENSG00000151892.10 | 3.001E-7 | 0 | 99882 | gtex_brain_putamen_basal |
| rs4751579 | 10 | 117933284 | GFRA1 | ENSG00000151892.10 | 2.513E-7 | 0 | 99695 | gtex_brain_putamen_basal |
| rs7080193 | 10 | 117933470 | GFRA1 | ENSG00000151892.10 | 7.278E-7 | 0 | 99509 | gtex_brain_putamen_basal |
| rs7080212 | 10 | 117933516 | GFRA1 | ENSG00000151892.10 | 4.662E-7 | 0 | 99463 | gtex_brain_putamen_basal |
| rs2420249 | 10 | 117955163 | GFRA1 | ENSG00000151892.10 | 1.806E-6 | 0 | 77816 | gtex_brain_putamen_basal |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| ABAT | 0.67 | 0.69 |
| KIAA1024 | 0.65 | 0.68 |
| LRRTM3 | 0.64 | 0.71 |
| SLITRK3 | 0.63 | 0.69 |
| SPATS2L | 0.63 | 0.61 |
| GUCY1A3 | 0.63 | 0.64 |
| LUZP2 | 0.63 | 0.67 |
| ALDH5A1 | 0.63 | 0.70 |
| RPAP3 | 0.63 | 0.65 |
| PDE4B | 0.63 | 0.61 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| AF347015.21 | -0.38 | -0.36 |
| AC098691.2 | -0.36 | -0.41 |
| MT-CO2 | -0.35 | -0.36 |
| FXYD1 | -0.35 | -0.32 |
| HIGD1B | -0.35 | -0.36 |
| S100A13 | -0.34 | -0.32 |
| MYL3 | -0.33 | -0.31 |
| AF347015.31 | -0.33 | -0.35 |
| CSAG1 | -0.33 | -0.31 |
| C1orf54 | -0.32 | -0.35 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0016167 | glial cell line-derived neurotrophic factor receptor activity | TAS | neurotrophic, Glial (GO term level: 7) | 10829012 |
| GO:0005102 | receptor binding | TAS | Neurotransmitter (GO term level: 4) | 9545641 |
| GO:0004872 | receptor activity | NAS | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007166 | cell surface receptor linked signal transduction | NAS | 8674117 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005886 | plasma membrane | IEA | - | |
| GO:0031225 | anchored to membrane | IEA | - | |
| GO:0019898 | extrinsic to membrane | NAS | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| PID RET PATHWAY | 39 | 29 | All SZGR 2.0 genes in this pathway |
| PID AJDISS 2PATHWAY | 48 | 38 | All SZGR 2.0 genes in this pathway |
| REACTOME DEVELOPMENTAL BIOLOGY | 396 | 292 | All SZGR 2.0 genes in this pathway |
| REACTOME AXON GUIDANCE | 251 | 188 | All SZGR 2.0 genes in this pathway |
| REACTOME NCAM1 INTERACTIONS | 39 | 27 | All SZGR 2.0 genes in this pathway |
| REACTOME NCAM SIGNALING FOR NEURITE OUT GROWTH | 64 | 49 | All SZGR 2.0 genes in this pathway |
| DOANE BREAST CANCER ESR1 UP | 112 | 72 | All SZGR 2.0 genes in this pathway |
| GOZGIT ESR1 TARGETS DN | 781 | 465 | All SZGR 2.0 genes in this pathway |
| MCBRYAN PUBERTAL TGFB1 TARGETS UP | 169 | 127 | All SZGR 2.0 genes in this pathway |
| FARMER BREAST CANCER APOCRINE VS LUMINAL | 326 | 213 | All SZGR 2.0 genes in this pathway |
| FARMER BREAST CANCER BASAL VS LULMINAL | 330 | 215 | All SZGR 2.0 genes in this pathway |
| MARTORIATI MDM4 TARGETS NEUROEPITHELIUM DN | 164 | 111 | All SZGR 2.0 genes in this pathway |
| PUJANA BRCA2 PCC NETWORK | 423 | 265 | All SZGR 2.0 genes in this pathway |
| BENPORATH SUZ12 TARGETS | 1038 | 678 | All SZGR 2.0 genes in this pathway |
| BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
| MORI MATURE B LYMPHOCYTE DN | 75 | 43 | All SZGR 2.0 genes in this pathway |
| LE EGR2 TARGETS DN | 108 | 84 | All SZGR 2.0 genes in this pathway |
| BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS | 882 | 572 | All SZGR 2.0 genes in this pathway |
| RODWELL AGING KIDNEY NO BLOOD UP | 222 | 139 | All SZGR 2.0 genes in this pathway |
| RODWELL AGING KIDNEY UP | 487 | 303 | All SZGR 2.0 genes in this pathway |
| DOUGLAS BMI1 TARGETS UP | 566 | 371 | All SZGR 2.0 genes in this pathway |
| CREIGHTON ENDOCRINE THERAPY RESISTANCE 1 | 528 | 324 | All SZGR 2.0 genes in this pathway |
| LEIN MIDBRAIN MARKERS | 82 | 55 | All SZGR 2.0 genes in this pathway |
| MASSARWEH TAMOXIFEN RESISTANCE DN | 258 | 160 | All SZGR 2.0 genes in this pathway |
| SMID BREAST CANCER RELAPSE IN BONE UP | 97 | 61 | All SZGR 2.0 genes in this pathway |
| SMID BREAST CANCER LUMINAL B UP | 172 | 109 | All SZGR 2.0 genes in this pathway |
| SMID BREAST CANCER LUMINAL A UP | 84 | 52 | All SZGR 2.0 genes in this pathway |
| SMID BREAST CANCER BASAL DN | 701 | 446 | All SZGR 2.0 genes in this pathway |
| BONOME OVARIAN CANCER SURVIVAL OPTIMAL DEBULKING | 246 | 152 | All SZGR 2.0 genes in this pathway |
| GRADE COLON CANCER UP | 871 | 505 | All SZGR 2.0 genes in this pathway |
| VANTVEER BREAST CANCER ESR1 UP | 167 | 99 | All SZGR 2.0 genes in this pathway |
| HOFFMANN SMALL PRE BII TO IMMATURE B LYMPHOCYTE DN | 50 | 33 | All SZGR 2.0 genes in this pathway |
| MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 | 1069 | 729 | All SZGR 2.0 genes in this pathway |
| POOLA INVASIVE BREAST CANCER DN | 134 | 83 | All SZGR 2.0 genes in this pathway |
| CHIANG LIVER CANCER SUBCLASS CTNNB1 UP | 176 | 110 | All SZGR 2.0 genes in this pathway |
| YAGI AML WITH T 9 11 TRANSLOCATION | 130 | 87 | All SZGR 2.0 genes in this pathway |
| YAGI AML WITH 11Q23 REARRANGED | 351 | 238 | All SZGR 2.0 genes in this pathway |
| DUTERTRE ESTRADIOL RESPONSE 24HR UP | 324 | 193 | All SZGR 2.0 genes in this pathway |
| CHYLA CBFA2T3 TARGETS UP | 387 | 225 | All SZGR 2.0 genes in this pathway |
| PEDERSEN METASTASIS BY ERBB2 ISOFORM 4 | 110 | 66 | All SZGR 2.0 genes in this pathway |
| GUO TARGETS OF IRS1 AND IRS2 | 98 | 67 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-381 | 67 | 74 | 1A,m8 | hsa-miR-381 | UAUACAAGGGCAAGCUCUCUGU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.