SZGR2

Summary ?

GeneID	273
Symbol	AMPH
Synonyms	AMPH1
Description	amphiphysin
Reference	MIM:600418\|HGNC:HGNC:471\|Ensembl:ENSG00000078053\|HPRD:02687\|Vega:OTTHUMG00000023725
Gene type	protein-coding
Map location	7p14-p13
Pascal p-value	0.25
Sherlock p-value	0.345
Fetal beta	-0.743
eGene	Myers' cis & trans
Support	EXOCYTOSIS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS G2Cdb.human_clathrin G2Cdb.human_Synaptosome CompositeSet Darnell FMRP targets

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 4
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.252

Section I. Genetics and epigenetics annotation

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs7132043	chr12	80968399	AMPH	273		0.11		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005515	protein binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007268	synaptic transmission	TAS	neuron, Synap, Neurotransmitter (GO term level: 6)	9182667
GO:0048488	synaptic vesicle endocytosis	IEA	axon, Synap, Neurotransmitter (GO term level: 7)	-
GO:0007612	learning	IEA		-
GO:0006897	endocytosis	TAS		9182667
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0008021	synaptic vesicle	IEA	Synap, Neurotransmitter (GO term level: 12)	-
GO:0008021	synaptic vesicle	TAS	Synap, Neurotransmitter (GO term level: 12)	1628617
GO:0045202	synapse	IEA	neuron, Synap, Neurotransmitter, Glial (GO term level: 2)	-
GO:0005737	cytoplasm	IEA		-
GO:0016020	membrane	IEA		-
GO:0015629	actin cytoskeleton	TAS		9182667
GO:0030054	cell junction	IEA		-
GO:0031410	cytoplasmic vesicle	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
AP1B1	ADTB1 \| AP105A \| BAM22 \| CLAPB2	adaptor-related protein complex 1, beta 1 subunit	Reconstituted Complex	BioGRID	9280305
AP2A2	ADTAB \| CLAPA2 \| HIP9 \| HYPJ	adaptor-related protein complex 2, alpha 2 subunit	Reconstituted Complex	BioGRID	9280305
BIN1	AMPH2 \| AMPHL \| DKFZp547F068 \| MGC10367 \| SH3P9	bridging integrator 1	-	HPRD,BioGRID	9348539
CABIN1	CAIN \| KIAA0330 \| PPP3IN	calcineurin binding protein 1	-	HPRD,BioGRID	10931822
CDK5R1	CDK5P35 \| CDK5R \| MGC33831 \| NCK5A \| p23 \| p25 \| p35 \| p35nck5a	cyclin-dependent kinase 5, regulatory subunit 1 (p35)	Amphiphysin 1 interacts with p35. This interaction was modeled on a demonstrated interaction between human amphiphysin 1 and rat p35.	BIND	11113134
CDK5R1	CDK5P35 \| CDK5R \| MGC33831 \| NCK5A \| p23 \| p25 \| p35 \| p35nck5a	cyclin-dependent kinase 5, regulatory subunit 1 (p35)	-	HPRD,BioGRID	11113134
CLTC	CHC \| CHC17 \| CLH-17 \| CLTCL2 \| Hc \| KIAA0034	clathrin, heavy chain (Hc)	-	HPRD	9195986 \|9280305 \|9603201
CLTC	CHC \| CHC17 \| CLH-17 \| CLTCL2 \| Hc \| KIAA0034	clathrin, heavy chain (Hc)	in vitro in vivo Reconstituted Complex	BioGRID	9195986 \|9603201
DNM1	DNM	dynamin 1	Affinity Capture-Western Reconstituted Complex	BioGRID	9148966 \|9280305 \|9341169 \|9348539 \|11877424
DNM1	DNM	dynamin 1	-	HPRD	9148966 \|9348539 \|9694653 \|11877424\|10899172
PLD1	-	phospholipase D1, phosphatidylcholine-specific	Affinity Capture-Western Phenotypic Suppression Reconstituted Complex	BioGRID	10764771
PLD2	-	phospholipase D2	-	HPRD,BioGRID	10764771
PTK2	FADK \| FAK \| FAK1 \| pp125FAK	PTK2 protein tyrosine kinase 2	Affinity Capture-Western	BioGRID	12558988
SH3GL2	CNSA2 \| EEN-B1 \| FLJ20276 \| FLJ25015 \| SH3D2A \| SH3P4	SH3-domain GRB2-like 2	Reconstituted Complex	BioGRID	9341169 \|12456676
SH3GL2	CNSA2 \| EEN-B1 \| FLJ20276 \| FLJ25015 \| SH3D2A \| SH3P4	SH3-domain GRB2-like 2	-	HPRD	9315708
SH3GLB1	Bif-1 \| CGI-61 \| KIAA0491 \| dJ612B15.2	SH3-domain GRB2-like endophilin B1	-	HPRD,BioGRID	12456676
SYN1	SYN1a \| SYN1b \| SYNI	synapsin I	-	HPRD,BioGRID	10899172
SYNJ1	INPP5G	synaptojanin 1	-	HPRD	10542231 \|14704270
SYNJ1	INPP5G	synaptojanin 1	Affinity Capture-Western Reconstituted Complex	BioGRID	9341169
VTN	V75 \| VN \| VNT	vitronectin	-	HPRD,BioGRID	12565847

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG FC GAMMA R MEDIATED PHAGOCYTOSIS	97	71	All SZGR 2.0 genes in this pathway
BIOCARTA NDKDYNAMIN PATHWAY	21	15	All SZGR 2.0 genes in this pathway
PID ERBB1 INTERNALIZATION PATHWAY	41	35	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 TTD DN	84	63	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 DN	855	609	All SZGR 2.0 genes in this pathway
MOHANKUMAR TLX1 TARGETS DN	193	112	All SZGR 2.0 genes in this pathway
SCHLESINGER H3K27ME3 IN NORMAL AND METHYLATED IN CANCER	28	21	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 12HR DN	57	45	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 48HR DN	428	306	All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3	1118	744	All SZGR 2.0 genes in this pathway
MOREAUX MULTIPLE MYELOMA BY TACI UP	412	249	All SZGR 2.0 genes in this pathway
WEIGEL OXIDATIVE STRESS RESPONSE	35	28	All SZGR 2.0 genes in this pathway
ZHENG BOUND BY FOXP3	491	310	All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 UNSTIMULATED	1229	713	All SZGR 2.0 genes in this pathway
ZHENG FOXP3 TARGETS IN THYMUS DN	12	9	All SZGR 2.0 genes in this pathway
TAVAZOIE METASTASIS	108	68	All SZGR 2.0 genes in this pathway
CROONQUIST NRAS VS STROMAL STIMULATION UP	41	26	All SZGR 2.0 genes in this pathway
KIM ALL DISORDERS CALB1 CORR UP	548	370	All SZGR 2.0 genes in this pathway
HOELZEL NF1 TARGETS DN	115	73	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-1/206	1073	1079	1A	hsa-miR-1	UGGAAUGUAAAGAAGUAUGUA
				hsa-miR-206^SZ	UGGAAUGUAAGGAAGUGUGUGG
				hsa-miR-613	AGGAAUGUUCCUUCUUUGCC
miR-153	977	983	1A	hsa-miR-153	UUGCAUAGUCACAAAAGUGA
miR-26	259	265	m8	hsa-miR-26a^brain	UUCAAGUAAUCCAGGAUAGGC
miR-26	259	265	m8	hsa-miR-26b^SZ	UUCAAGUAAUUCAGGAUAGGUU
miR-28	947	953	m8	hsa-miR-28^brain	AAGGAGCUCACAGUCUAUUGAG
miR-330	231	237	m8	hsa-miR-330^brain	GCAAAGCACACGGCCUGCAGAGA
miR-448	977	983	1A	hsa-miR-448	UUGCAUAUGUAGGAUGUCCCAU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: AMPH