Gene Page: RBMS3
Summary ?
GeneID | 27303 |
Symbol | RBMS3 |
Synonyms | - |
Description | RNA binding motif, single stranded interacting protein 3 |
Reference | MIM:605786|HGNC:HGNC:13427|Ensembl:ENSG00000144642|HPRD:16155|Vega:OTTHUMG00000155699 |
Gene type | protein-coding |
Map location | 3p24-p23 |
Pascal p-value | 3.946E-7 |
Fetal beta | -0.088 |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
GSMA_I | Genome scan meta-analysis | Psr: 0.006 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0000166 | nucleotide binding | IEA | - | |
GO:0003723 | RNA binding | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005737 | cytoplasm | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
DAVICIONI MOLECULAR ARMS VS ERMS DN | 182 | 111 | All SZGR 2.0 genes in this pathway |
SENGUPTA NASOPHARYNGEAL CARCINOMA WITH LMP1 UP | 408 | 247 | All SZGR 2.0 genes in this pathway |
THUM SYSTOLIC HEART FAILURE UP | 423 | 283 | All SZGR 2.0 genes in this pathway |
HUTTMANN B CLL POOR SURVIVAL UP | 276 | 187 | All SZGR 2.0 genes in this pathway |
CHARAFE BREAST CANCER LUMINAL VS BASAL DN | 455 | 304 | All SZGR 2.0 genes in this pathway |
CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL DN | 460 | 312 | All SZGR 2.0 genes in this pathway |
VECCHI GASTRIC CANCER EARLY DN | 367 | 220 | All SZGR 2.0 genes in this pathway |
SENESE HDAC1 AND HDAC2 TARGETS DN | 232 | 139 | All SZGR 2.0 genes in this pathway |
SENESE HDAC3 TARGETS DN | 536 | 332 | All SZGR 2.0 genes in this pathway |
KINSEY TARGETS OF EWSR1 FLII FUSION DN | 329 | 219 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN | 805 | 505 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA ANAPLASTIC DN | 537 | 339 | All SZGR 2.0 genes in this pathway |
LASTOWSKA NEUROBLASTOMA COPY NUMBER DN | 800 | 473 | All SZGR 2.0 genes in this pathway |
NUYTTEN NIPP1 TARGETS UP | 769 | 437 | All SZGR 2.0 genes in this pathway |
NUYTTEN EZH2 TARGETS UP | 1037 | 673 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN | 514 | 330 | All SZGR 2.0 genes in this pathway |
SCHAEFFER PROSTATE DEVELOPMENT 48HR DN | 428 | 306 | All SZGR 2.0 genes in this pathway |
PENG RAPAMYCIN RESPONSE UP | 203 | 130 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 14HR DN | 298 | 200 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 18HR DN | 178 | 121 | All SZGR 2.0 genes in this pathway |
RODWELL AGING KIDNEY NO BLOOD UP | 222 | 139 | All SZGR 2.0 genes in this pathway |
RODWELL AGING KIDNEY UP | 487 | 303 | All SZGR 2.0 genes in this pathway |
KONDO EZH2 TARGETS | 245 | 148 | All SZGR 2.0 genes in this pathway |
MOLENAAR TARGETS OF CCND1 AND CDK4 UP | 67 | 48 | All SZGR 2.0 genes in this pathway |
WEST ADRENOCORTICAL TUMOR DN | 546 | 362 | All SZGR 2.0 genes in this pathway |
CHEN METABOLIC SYNDROM NETWORK | 1210 | 725 | All SZGR 2.0 genes in this pathway |
MIKKELSEN NPC ICP WITH H3K4ME3 | 445 | 257 | All SZGR 2.0 genes in this pathway |
CHICAS RB1 TARGETS GROWING | 243 | 155 | All SZGR 2.0 genes in this pathway |
PANGAS TUMOR SUPPRESSION BY SMAD1 AND SMAD5 UP | 134 | 85 | All SZGR 2.0 genes in this pathway |
JOHNSTONE PARVB TARGETS 2 DN | 336 | 211 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE LATE | 1137 | 655 | All SZGR 2.0 genes in this pathway |
MIYAGAWA TARGETS OF EWSR1 ETS FUSIONS DN | 229 | 135 | All SZGR 2.0 genes in this pathway |
SERVITJA ISLET HNF1A TARGETS UP | 163 | 111 | All SZGR 2.0 genes in this pathway |
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-124.1 | 526 | 533 | 1A,m8 | hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA |
miR-124/506 | 526 | 532 | 1A | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
miR-129-5p | 1070 | 1077 | 1A,m8 | hsa-miR-129brain | CUUUUUGCGGUCUGGGCUUGC |
hsa-miR-129-5p | CUUUUUGCGGUCUGGGCUUGCU | ||||
hsa-miR-129brain | CUUUUUGCGGUCUGGGCUUGC | ||||
hsa-miR-129-5p | CUUUUUGCGGUCUGGGCUUGCU | ||||
miR-137 | 1091 | 1098 | 1A,m8 | hsa-miR-137 | UAUUGCUUAAGAAUACGCGUAG |
miR-19 | 76 | 83 | 1A,m8 | hsa-miR-19a | UGUGCAAAUCUAUGCAAAACUGA |
hsa-miR-19b | UGUGCAAAUCCAUGCAAAACUGA | ||||
miR-21 | 426 | 432 | 1A | hsa-miR-21brain | UAGCUUAUCAGACUGAUGUUGA |
hsa-miR-590 | GAGCUUAUUCAUAAAAGUGCAG | ||||
miR-320 | 985 | 991 | m8 | hsa-miR-320 | AAAAGCUGGGUUGAGAGGGCGAA |
miR-363 | 1068 | 1074 | 1A | hsa-miR-363 | AUUGCACGGUAUCCAUCUGUAA |
miR-433-3p | 766 | 772 | 1A | hsa-miR-433brain | AUCAUGAUGGGCUCCUCGGUGU |
miR-450 | 1070 | 1076 | 1A | hsa-miR-450 | UUUUUGCGAUGUGUUCCUAAUA |
miR-542-3p | 995 | 1001 | 1A | hsa-miR-542-3p | UGUGACAGAUUGAUAACUGAAA |
miR-9 | 1175 | 1182 | 1A,m8 | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.