Gene Page: ARCN1
Summary ?
| GeneID | 372 |
| Symbol | ARCN1 |
| Synonyms | COPD |
| Description | archain 1 |
| Reference | MIM:600820|HGNC:HGNC:649|Ensembl:ENSG00000095139|HPRD:02893|Vega:OTTHUMG00000166340 |
| Gene type | protein-coding |
| Map location | 11q23.3 |
| Pascal p-value | 0.078 |
| Sherlock p-value | 0.154 |
| Fetal beta | -0.002 |
| eGene | Cerebellar Hemisphere |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| GSMA_I | Genome scan meta-analysis | Psr: 0.006 | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| C20orf3 | 0.90 | 0.86 |
| LDOC1 | 0.89 | 0.86 |
| GORASP2 | 0.89 | 0.89 |
| FAM50B | 0.89 | 0.88 |
| MAEA | 0.89 | 0.86 |
| FARSA | 0.89 | 0.86 |
| WRNIP1 | 0.89 | 0.87 |
| USP11 | 0.89 | 0.85 |
| DHX30 | 0.89 | 0.87 |
| PPP2R1A | 0.88 | 0.88 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| AF347015.21 | -0.77 | -0.76 |
| MT-CO2 | -0.76 | -0.72 |
| AF347015.8 | -0.74 | -0.71 |
| AF347015.33 | -0.73 | -0.71 |
| AF347015.31 | -0.73 | -0.71 |
| NOSTRIN | -0.72 | -0.70 |
| MT-CYB | -0.72 | -0.69 |
| AF347015.2 | -0.71 | -0.67 |
| AF347015.26 | -0.71 | -0.69 |
| AF347015.27 | -0.70 | -0.71 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005515 | protein binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0016044 | membrane organization | EXP | 11031247 | |
| GO:0006810 | transport | IEA | - | |
| GO:0006886 | intracellular protein transport | IEA | - | |
| GO:0006886 | intracellular protein transport | TAS | 7782067 | |
| GO:0006890 | retrograde vesicle-mediated transport, Golgi to ER | EXP | 11031247 | |
| GO:0016192 | vesicle-mediated transport | IEA | - | |
| GO:0048205 | COPI coating of Golgi vesicle | EXP | 16956762 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0000139 | Golgi membrane | IEA | - | |
| GO:0005794 | Golgi apparatus | IEA | - | |
| GO:0005829 | cytosol | EXP | 8533093 |8599108 | |
| GO:0005737 | cytoplasm | IEA | - | |
| GO:0016020 | membrane | IEA | - | |
| GO:0031410 | cytoplasmic vesicle | IEA | - | |
| GO:0030131 | clathrin adaptor complex | IEA | - | |
| GO:0030126 | COPI vesicle coat | ISS | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| REACTOME MEMBRANE TRAFFICKING | 129 | 74 | All SZGR 2.0 genes in this pathway |
| DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP | 1382 | 904 | All SZGR 2.0 genes in this pathway |
| WANG LMO4 TARGETS DN | 352 | 225 | All SZGR 2.0 genes in this pathway |
| MARKEY RB1 ACUTE LOF DN | 228 | 137 | All SZGR 2.0 genes in this pathway |
| LASTOWSKA NEUROBLASTOMA COPY NUMBER DN | 800 | 473 | All SZGR 2.0 genes in this pathway |
| SCHLOSSER SERUM RESPONSE DN | 712 | 443 | All SZGR 2.0 genes in this pathway |
| MARTORIATI MDM4 TARGETS NEUROEPITHELIUM DN | 164 | 111 | All SZGR 2.0 genes in this pathway |
| MOHANKUMAR TLX1 TARGETS UP | 414 | 287 | All SZGR 2.0 genes in this pathway |
| PUJANA BRCA1 PCC NETWORK | 1652 | 1023 | All SZGR 2.0 genes in this pathway |
| NUYTTEN EZH2 TARGETS DN | 1024 | 594 | All SZGR 2.0 genes in this pathway |
| KENNY CTNNB1 TARGETS UP | 50 | 30 | All SZGR 2.0 genes in this pathway |
| NING CHRONIC OBSTRUCTIVE PULMONARY DISEASE UP | 157 | 105 | All SZGR 2.0 genes in this pathway |
| IVANOVA HEMATOPOIESIS EARLY PROGENITOR | 532 | 309 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
| RAMALHO STEMNESS UP | 206 | 118 | All SZGR 2.0 genes in this pathway |
| KAYO AGING MUSCLE UP | 244 | 165 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE INCIPIENT DN | 165 | 106 | All SZGR 2.0 genes in this pathway |
| KAYO CALORIE RESTRICTION MUSCLE UP | 95 | 64 | All SZGR 2.0 genes in this pathway |
| MARSON BOUND BY FOXP3 UNSTIMULATED | 1229 | 713 | All SZGR 2.0 genes in this pathway |
| MARTINEZ RB1 TARGETS UP | 673 | 430 | All SZGR 2.0 genes in this pathway |
| MARTINEZ TP53 TARGETS UP | 602 | 364 | All SZGR 2.0 genes in this pathway |
| MARTINEZ RB1 AND TP53 TARGETS UP | 601 | 369 | All SZGR 2.0 genes in this pathway |
| SWEET LUNG CANCER KRAS UP | 491 | 316 | All SZGR 2.0 genes in this pathway |
| ROME INSULIN TARGETS IN MUSCLE UP | 442 | 263 | All SZGR 2.0 genes in this pathway |
| YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 10 | 69 | 38 | All SZGR 2.0 genes in this pathway |
| KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP | 756 | 494 | All SZGR 2.0 genes in this pathway |
| CHYLA CBFA2T3 TARGETS DN | 242 | 146 | All SZGR 2.0 genes in this pathway |
| IKEDA MIR1 TARGETS UP | 53 | 39 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-1/206 | 2154 | 2161 | 1A,m8 | hsa-miR-1 | UGGAAUGUAAAGAAGUAUGUA |
| hsa-miR-206SZ | UGGAAUGUAAGGAAGUGUGUGG | ||||
| hsa-miR-613 | AGGAAUGUUCCUUCUUUGCC | ||||
| miR-125/351 | 1898 | 1904 | 1A | hsa-miR-125bbrain | UCCCUGAGACCCUAACUUGUGA |
| hsa-miR-125abrain | UCCCUGAGACCCUUUAACCUGUG | ||||
| miR-15/16/195/424/497 | 1157 | 1163 | m8 | hsa-miR-15abrain | UAGCAGCACAUAAUGGUUUGUG |
| hsa-miR-16brain | UAGCAGCACGUAAAUAUUGGCG | ||||
| hsa-miR-15bbrain | UAGCAGCACAUCAUGGUUUACA | ||||
| hsa-miR-195SZ | UAGCAGCACAGAAAUAUUGGC | ||||
| hsa-miR-424 | CAGCAGCAAUUCAUGUUUUGAA | ||||
| hsa-miR-497 | CAGCAGCACACUGUGGUUUGU | ||||
| miR-185 | 266 | 272 | 1A | hsa-miR-185brain | UGGAGAGAAAGGCAGUUC |
| miR-204/211 | 209 | 216 | 1A,m8 | hsa-miR-204brain | UUCCCUUUGUCAUCCUAUGCCU |
| hsa-miR-211 | UUCCCUUUGUCAUCCUUCGCCU | ||||
| miR-370 | 251 | 258 | 1A,m8 | hsa-miR-370brain | GCCUGCUGGGGUGGAACCUGG |
| miR-374 | 2203 | 2209 | 1A | hsa-miR-374 | UUAUAAUACAACCUGAUAAGUG |
| miR-409-3p | 2153 | 2159 | m8 | hsa-miR-409-3p | CGAAUGUUGCUCGGUGAACCCCU |
| miR-9 | 1859 | 1865 | 1A | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.