Gene Page: KCNA3
Summary ?
GeneID | 3738 |
Symbol | KCNA3 |
Synonyms | HGK5|HLK3|HPCN3|HUKIII|KV1.3|MK3|PCN3 |
Description | potassium voltage-gated channel subfamily A member 3 |
Reference | MIM:176263|HGNC:HGNC:6221|Ensembl:ENSG00000177272|HPRD:15937|Vega:OTTHUMG00000034493 |
Gene type | protein-coding |
Map location | 1p13.3 |
Pascal p-value | 0.344 |
Fetal beta | -0.535 |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
CV:PGCnp | Genome-wide Association Study | GWAS | |
GSMA_I | Genome scan meta-analysis | Psr: 0.0235 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
![Not available](/SZGR/GeneImg/KCNA3_DE_GTEx.png)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
CLCN4 | 0.78 | 0.84 |
ERC2 | 0.78 | 0.86 |
CLSTN2 | 0.78 | 0.87 |
PRICKLE2 | 0.77 | 0.81 |
ADRBK2 | 0.77 | 0.86 |
HECW2 | 0.77 | 0.80 |
NRCAM | 0.76 | 0.81 |
ITGA9 | 0.76 | 0.81 |
ZYG11B | 0.75 | 0.82 |
ASTN1 | 0.74 | 0.80 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
FXYD1 | -0.53 | -0.62 |
RAB34 | -0.53 | -0.63 |
TLCD1 | -0.51 | -0.59 |
HIGD1B | -0.51 | -0.63 |
AF347015.31 | -0.50 | -0.61 |
ACSF2 | -0.50 | -0.61 |
MT-CO2 | -0.50 | -0.63 |
AF347015.33 | -0.50 | -0.59 |
AF347015.21 | -0.50 | -0.62 |
SLC25A18 | -0.50 | -0.58 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005515 | protein binding | IEA | - | |
GO:0005244 | voltage-gated ion channel activity | TAS | 1373731 | |
GO:0005251 | delayed rectifier potassium channel activity | TAS | 1986382 | |
GO:0030955 | potassium ion binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006811 | ion transport | IEA | - | |
GO:0006813 | potassium ion transport | TAS | 1373731 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0016020 | membrane | IEA | - | |
GO:0016021 | integral to membrane | IEA | - | |
GO:0008076 | voltage-gated potassium channel complex | TAS | 1373731 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
REACTOME NEURONAL SYSTEM | 279 | 221 | All SZGR 2.0 genes in this pathway |
REACTOME VOLTAGE GATED POTASSIUM CHANNELS | 43 | 32 | All SZGR 2.0 genes in this pathway |
REACTOME POTASSIUM CHANNELS | 98 | 68 | All SZGR 2.0 genes in this pathway |
LIU TARGETS OF VMYB VS CMYB DN | 43 | 30 | All SZGR 2.0 genes in this pathway |
BENPORATH SUZ12 TARGETS | 1038 | 678 | All SZGR 2.0 genes in this pathway |
BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
BENPORATH PRC2 TARGETS | 652 | 441 | All SZGR 2.0 genes in this pathway |
MARSON BOUND BY FOXP3 STIMULATED | 1022 | 619 | All SZGR 2.0 genes in this pathway |
MARSON BOUND BY FOXP3 UNSTIMULATED | 1229 | 713 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 | 1069 | 729 | All SZGR 2.0 genes in this pathway |
MEISSNER NPC HCP WITH H3K4ME2 AND H3K27ME3 | 349 | 234 | All SZGR 2.0 genes in this pathway |
MIKKELSEN NPC HCP WITH H3K4ME3 AND H3K27ME3 | 210 | 148 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE VIA TP53 GROUP D | 280 | 158 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-203.1 | 78 | 84 | m8 | hsa-miR-203 | UGAAAUGUUUAGGACCACUAG |
miR-204/211 | 600 | 607 | 1A,m8 | hsa-miR-204brain | UUCCCUUUGUCAUCCUAUGCCU |
hsa-miR-211 | UUCCCUUUGUCAUCCUUCGCCU | ||||
miR-21 | 800 | 806 | m8 | hsa-miR-21brain | UAGCUUAUCAGACUGAUGUUGA |
hsa-miR-590 | GAGCUUAUUCAUAAAAGUGCAG | ||||
miR-217 | 879 | 885 | m8 | hsa-miR-217 | UACUGCAUCAGGAACUGAUUGGAU |
miR-218 | 122 | 128 | m8 | hsa-miR-218brain | UUGUGCUUGAUCUAACCAUGU |
miR-30-3p | 158 | 164 | m8 | hsa-miR-30a-3p | CUUUCAGUCGGAUGUUUGCAGC |
hsa-miR-30e-3p | CUUUCAGUCGGAUGUUUACAGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.