Gene Page: KCNN3
Summary ?
| GeneID | 3782 |
| Symbol | KCNN3 |
| Synonyms | KCa2.3|SK3|SKCA3|hSK3 |
| Description | potassium calcium-activated channel subfamily N member 3 |
| Reference | MIM:602983|HGNC:HGNC:6292|Ensembl:ENSG00000143603|HPRD:04283|Vega:OTTHUMG00000037260 |
| Gene type | protein-coding |
| Map location | 1q21.3 |
| Sherlock p-value | 0.258 |
| Fetal beta | 1.523 |
| eGene | Myers' cis & trans |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:GWASdb | Genome-wide Association Studies | GWASdb records for schizophrenia | |
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Association | A combined odds ratio method (Sun et al. 2008), association studies | 2 | Link to SZGene |
| GSMA_I | Genome scan meta-analysis | Psr: 0.0235 | |
| GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00814 | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenics,schizophrenias | Click to show details |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 2 |
Section I. Genetics and epigenetics annotation
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs17070904 | chr18 | 60917055 | KCNN3 | 3782 | 0.17 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005516 | calmodulin binding | IEA | - | |
| GO:0005216 | ion channel activity | IEA | - | |
| GO:0016286 | small conductance calcium-activated potassium channel activity | IEA | - | |
| GO:0015269 | calcium-activated potassium channel activity | IEA | - | |
| GO:0015269 | calcium-activated potassium channel activity | TAS | 8781233 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007268 | synaptic transmission | TAS | neuron, Synap, Neurotransmitter (GO term level: 6) | 8781233 |
| GO:0007399 | nervous system development | TAS | neurite (GO term level: 5) | 9491810 |
| GO:0006813 | potassium ion transport | IEA | - | |
| GO:0006813 | potassium ion transport | TAS | 8781233 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0016020 | membrane | IEA | - | |
| GO:0016021 | integral to membrane | IEA | - | |
| GO:0008076 | voltage-gated potassium channel complex | TAS | 8781233 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| REACTOME NEURONAL SYSTEM | 279 | 221 | All SZGR 2.0 genes in this pathway |
| REACTOME POTASSIUM CHANNELS | 98 | 68 | All SZGR 2.0 genes in this pathway |
| HOLLMANN APOPTOSIS VIA CD40 UP | 201 | 125 | All SZGR 2.0 genes in this pathway |
| DAVICIONI PAX FOXO1 SIGNATURE IN ARMS UP | 59 | 38 | All SZGR 2.0 genes in this pathway |
| DAVICIONI MOLECULAR ARMS VS ERMS UP | 332 | 228 | All SZGR 2.0 genes in this pathway |
| DAVICIONI TARGETS OF PAX FOXO1 FUSIONS UP | 255 | 177 | All SZGR 2.0 genes in this pathway |
| GARY CD5 TARGETS UP | 473 | 314 | All SZGR 2.0 genes in this pathway |
| PUJANA BRCA1 PCC NETWORK | 1652 | 1023 | All SZGR 2.0 genes in this pathway |
| BASSO CD40 SIGNALING DN | 68 | 44 | All SZGR 2.0 genes in this pathway |
| REN ALVEOLAR RHABDOMYOSARCOMA UP | 98 | 64 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
| HELLER HDAC TARGETS DN | 292 | 189 | All SZGR 2.0 genes in this pathway |
| HELLER HDAC TARGETS SILENCED BY METHYLATION DN | 281 | 179 | All SZGR 2.0 genes in this pathway |
| YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
| SHEDDEN LUNG CANCER GOOD SURVIVAL A12 | 317 | 177 | All SZGR 2.0 genes in this pathway |
| YOSHIOKA LIVER CANCER EARLY RECURRENCE UP | 40 | 23 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN MEF ICP WITH H3K27ME3 | 206 | 108 | All SZGR 2.0 genes in this pathway |
| ZHAN MULTIPLE MYELOMA HP DN | 47 | 23 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN ES ICP WITH H3K4ME3 AND H3K27ME3 | 137 | 85 | All SZGR 2.0 genes in this pathway |
| WIEDERSCHAIN TARGETS OF BMI1 AND PCGF2 | 57 | 39 | All SZGR 2.0 genes in this pathway |
| SMIRNOV RESPONSE TO IR 2HR DN | 55 | 35 | All SZGR 2.0 genes in this pathway |
| SMIRNOV RESPONSE TO IR 6HR UP | 166 | 97 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-122 | 12 | 18 | 1A | hsa-miR-122a | UGGAGUGUGACAAUGGUGUUUGU |
| miR-150 | 206 | 212 | m8 | hsa-miR-150 | UCUCCCAACCCUUGUACCAGUG |
| miR-155 | 21 | 27 | m8 | hsa-miR-155 | UUAAUGCUAAUCGUGAUAGGGG |
| miR-185 | 55 | 61 | m8 | hsa-miR-185brain | UGGAGAGAAAGGCAGUUC |
| miR-208 | 35 | 41 | 1A | hsa-miR-208 | AUAAGACGAGCAAAAAGCUUGU |
| miR-499 | 35 | 41 | 1A | hsa-miR-499 | UUAAGACUUGCAGUGAUGUUUAA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.