Summary ?
GeneID3790
SymbolKCNS3
SynonymsKV9.3
Descriptionpotassium voltage-gated channel modifier subfamily S member 3
ReferenceMIM:603888|HGNC:HGNC:6302|Ensembl:ENSG00000170745|HPRD:04865|Vega:OTTHUMG00000044150
Gene typeprotein-coding
Map location2p24
Pascal p-value1.994E-5
Fetal beta-2.223
DMG2 (# studies)
eGeneCaudate basal ganglia

Gene in Data Sources
Gene set name Method of gene setDescriptionInfo
CV:PGCnpGenome-wide Association StudyGWAS
DMG:Nishioka_2013Genome-wide DNA methylation analysisThe authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls. 2
DMG:Wockner_2014Genome-wide DNA methylation analysisThis dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). 2
PMID:cooccurHigh-throughput literature-searchSystematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
ExpressionMeta-analysis of gene expressionP value: 1.544 
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: schizophrenia,schizophreniasClick to show details

Section I. Genetics and epigenetics annotation

@Differentially methylated gene

ProbeChromosomePositionNearest geneP (dis)Beta (dis)FDR (dis)Study
cg26119806218061572KCNS33.38E-4-0.7070.041DMG:Wockner_2014
cg20940661218060086KCNS3-0.0220.46DMG:Nishioka_2013


Section II. Transcriptome annotation

General gene expression (GTEx)

Not available

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
GenePearson's Correlation Spearman's Correlation
LRP120.820.90
WDR470.820.90
SMAP10.810.90
PANK10.800.88
PAPD50.800.90
RALGPS20.800.88
GFPT10.800.88
TTC130.800.87
VEZT0.800.89
TRIM360.800.87
Top 10 negatively co-expressed genes
GenePearson's Correlation Spearman's Correlation
MT-CO2-0.64-0.82
AF347015.31-0.64-0.80
AF347015.33-0.63-0.78
FXYD1-0.62-0.79
MT-CYB-0.61-0.77
HIGD1B-0.61-0.79
AF347015.27-0.60-0.76
HLA-F-0.60-0.69
AF347015.8-0.60-0.78
IFI27-0.60-0.76

Section III. Gene Ontology annotation

Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIEA-
GO:0005244voltage-gated ion channel activityIEA-
GO:0005251delayed rectifier potassium channel activityTAS10484328 
GO:0015459potassium channel regulator activityTAS10484328 
GO:0030955potassium ion bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006811ion transportIEA-
GO:0006813potassium ion transportTAS10484328 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0016021integral to membraneIEA-
GO:0005886plasma membraneIEA-
GO:0008076voltage-gated potassium channel complexIEA-

Section V. Pathway annotation

Pathway namePathway size# SZGR 2.0 genes in pathwayInfo
REACTOME NEURONAL SYSTEM 279221All SZGR 2.0 genes in this pathway
REACTOME INTEGRATION OF ENERGY METABOLISM 12084All SZGR 2.0 genes in this pathway
REACTOME REGULATION OF INSULIN SECRETION BY GLUCAGON LIKE PEPTIDE1 4328All SZGR 2.0 genes in this pathway
REACTOME REGULATION OF INSULIN SECRETION 9365All SZGR 2.0 genes in this pathway
REACTOME VOLTAGE GATED POTASSIUM CHANNELS 4332All SZGR 2.0 genes in this pathway
REACTOME POTASSIUM CHANNELS 9868All SZGR 2.0 genes in this pathway
ONKEN UVEAL MELANOMA DN 526357All SZGR 2.0 genes in this pathway
DAVICIONI PAX FOXO1 SIGNATURE IN ARMS UP 5938All SZGR 2.0 genes in this pathway
IGARASHI ATF4 TARGETS DN 9065All SZGR 2.0 genes in this pathway
DAVICIONI TARGETS OF PAX FOXO1 FUSIONS UP 255177All SZGR 2.0 genes in this pathway
LIU CMYB TARGETS UP 165106All SZGR 2.0 genes in this pathway
LIU VMYB TARGETS UP 12778All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 SIGNATURE 3 UP 341197All SZGR 2.0 genes in this pathway
OZEN MIR125B1 TARGETS 2515All SZGR 2.0 genes in this pathway
BENPORATH ES 1 379235All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3 1118744All SZGR 2.0 genes in this pathway
GEORGES TARGETS OF MIR192 AND MIR215 893528All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 18HR UP 178111All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 3 720440All SZGR 2.0 genes in this pathway
BOQUEST STEM CELL CULTURED VS FRESH UP 425298All SZGR 2.0 genes in this pathway
SHEDDEN LUNG CANCER GOOD SURVIVAL A4 196124All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3 1069729All SZGR 2.0 genes in this pathway
MEISSNER NPC HCP WITH H3K4ME2 AND H3K27ME3 349234All SZGR 2.0 genes in this pathway
MIKKELSEN NPC HCP WITH H3K27ME3 341243All SZGR 2.0 genes in this pathway
ZWANG EGF INTERVAL DN 214124All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-125/35195101m8hsa-miR-125bbrainUCCCUGAGACCCUAACUUGUGA
hsa-miR-125abrainUCCCUGAGACCCUUUAACCUGUG
miR-1351121181Ahsa-miR-135aUAUGGCUUUUUAUUCCUAUGUGA
hsa-miR-135bUAUGGCUUUUCAUUCCUAUGUG
miR-142-5p56621Ahsa-miR-142-5pCAUAAAGUAGAAAGCACUAC
miR-32053601A,m8hsa-miR-320AAAAGCUGGGUUGAGAGGGCGAA
miR-33400406m8hsa-miR-33GUGCAUUGUAGUUGCAUUG
hsa-miR-33bGUGCAUUGCUGUUGCAUUGCA
miR-409-3p1241301Ahsa-miR-409-3pCGAAUGUUGCUCGGUGAACCCCU
miR-496377383m8hsa-miR-496AUUACAUGGCCAAUCUC
hsa-miR-496AUUACAUGGCCAAUCUC