SZGR2

Summary ?

GeneID	409
Symbol	ARRB2
Synonyms	ARB2\|ARR2\|BARR2
Description	arrestin, beta 2
Reference	MIM:107941\|HGNC:HGNC:712\|Ensembl:ENSG00000141480\|HPRD:00147\|Vega:OTTHUMG00000090759
Gene type	protein-coding
Map location	17p13
Pascal p-value	0.271
Sherlock p-value	0.065
Fetal beta	-0.516

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DNM:Guipponi_2014	Whole Exome Sequencing analysis	49 DNMs were identified by comparing the exome of 53 individuals with sporadic SCZ and of their non-affected parents
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias	Click to show details

Section I. Genetics and epigenetics annotation

DNM table

Gene	Chromosome	Position	Ref	Alt	Transcript	AA change	Mutation type	Sift	CG46	Trait	Study
ARRB2			G	A	NM_001257331	p.P161P	synonymous	NA	NA	Schizophrenia	DNM:Guipponi_2014

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
ADAM23	0.91	0.89
ATP2A2	0.91	0.91
AAK1	0.90	0.87
MAP7D2	0.90	0.87
KCNC2	0.88	0.74
PPM1H	0.88	0.83
KCND3	0.88	0.87
ANKRD34C	0.88	0.59
CDS1	0.88	0.85
PAQR9	0.87	0.84

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
RAB13	-0.40	-0.53
EFEMP2	-0.40	-0.41
RAB34	-0.39	-0.49
RPL35	-0.38	-0.43
BCL7C	-0.38	-0.44
GTF3C6	-0.38	-0.33
NME4	-0.37	-0.46
C1orf61	-0.37	-0.52
AC006276.2	-0.37	-0.35
RPL31	-0.36	-0.37

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005515	protein binding	IEA		-
GO:0005515	protein binding	IPI		17353931 \|17620599
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0001932	regulation of protein amino acid phosphorylation	IEA		-
GO:0007165	signal transduction	IEA		-
GO:0007179	transforming growth factor beta receptor signaling pathway	IDA		12958365
GO:0008277	regulation of G-protein coupled receptor protein signaling pathway	IEA		-
GO:0007600	sensory perception	IEA		-
GO:0031623	receptor internalization	IDA		12958365
GO:0050896	response to stimulus	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005622	intracellular	IEA		-
GO:0005634	nucleus	IEA		-
GO:0005737	cytoplasm	IEA		-
GO:0005886	plasma membrane	TAS		9346876
GO:0031410	cytoplasmic vesicle	IDA		12958365

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
AGTR1	AG2S \| AGTR1A \| AGTR1B \| AT1 \| AT1B \| AT1R \| AT2R1 \| AT2R1A \| AT2R1B \| HAT1R	angiotensin II receptor, type 1	-	HPRD	11279203
AP1B1	ADTB1 \| AP105A \| BAM22 \| CLAPB2	adaptor-related protein complex 1, beta 1 subunit	-	HPRD	10097102 \|12070169
AP2B1	ADTB2 \| AP105B \| AP2-BETA \| CLAPB1 \| DKFZp781K0743	adaptor-related protein complex 2, beta 1 subunit	Reconstituted Complex Two-hybrid	BioGRID	10097102 \|12070169
AP3B1	ADTB3 \| ADTB3A \| HPS \| HPS2 \| PE	adaptor-related protein complex 3, beta 1 subunit	Affinity Capture-MS	BioGRID	17353931
ARF6	DKFZp564M0264	ADP-ribosylation factor 6	-	HPRD,BioGRID	11533043 \|11867621
ARRB1	ARB1 \| ARR1	arrestin, beta 1	Affinity Capture-MS	BioGRID	17353931
AVPR2	ADHR \| DI1 \| DIR \| DIR3 \| MGC126533 \| MGC138386 \| NDI \| V2R	arginine vasopressin receptor 2	-	HPRD,BioGRID	12473660
BOP1	KIAA0124	block of proliferation 1	Affinity Capture-MS	BioGRID	17353931
CLTC	CHC \| CHC17 \| CLH-17 \| CLTCL2 \| Hc \| KIAA0034	clathrin, heavy chain (Hc)	-	HPRD	10097102
CYTH2	ARNO \| CTS18 \| CTS18.1 \| PSCD2 \| PSCD2L \| SEC7L \| Sec7p-L \| Sec7p-like	cytohesin 2	-	HPRD,BioGRID	11533043
DDX27	DKFZp667N057 \| FLJ12917 \| FLJ20596 \| FLJ22238 \| HSPC259 \| MGC1018 \| MGC163147 \| PP3241 \| RHLP \| Rrp3p \| dJ686N3.1	DEAD (Asp-Glu-Ala-Asp) box polypeptide 27	Affinity Capture-MS	BioGRID	17353931
FBL	FIB \| FLRN \| RNU3IP1	fibrillarin	Affinity Capture-MS	BioGRID	17353931
KPNA3	IPOA4 \| SRP1gamma \| SRP4 \| hSRP1	karyopherin alpha 3 (importin alpha 4)	Affinity Capture-MS	BioGRID	17353931
KPNA4	IPOA3 \| MGC12217 \| MGC26703 \| QIP1 \| SRP3	karyopherin alpha 4 (importin alpha 3)	Affinity Capture-MS	BioGRID	17353931
LHCGR	FLJ41504 \| LCGR \| LGR2 \| LH/CG-R \| LH/CGR \| LHR \| LHRHR \| LSH-R	luteinizing hormone/choriogonadotropin receptor	Reconstituted Complex	BioGRID	11867621
MAP2K4	JNKK \| JNKK1 \| MAPKK4 \| MEK4 \| MKK4 \| PRKMK4 \| SEK1 \| SERK1	mitogen-activated protein kinase kinase 4	-	HPRD,BioGRID	11090355
MAP3K5	ASK1 \| MAPKKK5 \| MEKK5	mitogen-activated protein kinase kinase kinase 5	Affinity Capture-Western	BioGRID	11090355
MAP3K5	ASK1 \| MAPKKK5 \| MEKK5	mitogen-activated protein kinase kinase kinase 5	-	HPRD	11356842
MAPK10	FLJ12099 \| FLJ33785 \| JNK3 \| JNK3A \| MGC50974 \| PRKM10 \| p493F12 \| p54bSAPK	mitogen-activated protein kinase 10	-	HPRD,BioGRID	11090355 \|11356842
MAPK10	FLJ12099 \| FLJ33785 \| JNK3 \| JNK3A \| MGC50974 \| PRKM10 \| p493F12 \| p54bSAPK	mitogen-activated protein kinase 10	-	HPRD	11090355
MAPK3	ERK1 \| HS44KDAP \| HUMKER1A \| MGC20180 \| P44ERK1 \| P44MAPK \| PRKM3	mitogen-activated protein kinase 3	Affinity Capture-Western	BioGRID	12473660
MDM2	HDMX \| MGC71221 \| hdm2	Mdm2 p53 binding protein homolog (mouse)	-	HPRD,BioGRID	12488444 \|12538596
MDM2	HDMX \| MGC71221 \| hdm2	Mdm2 p53 binding protein homolog (mouse)	-	HPRD	11588219 \|12488444 \|12538596\|12488444 \|12538596
MED8	ARC32 \| MGC17544 \| MGC19641	mediator complex subunit 8	Two-hybrid	BioGRID	16169070
MRPL43	MGC17989 \| MGC48892 \| bMRP36a	mitochondrial ribosomal protein L43	Affinity Capture-MS	BioGRID	17353931
MRPL44	FLJ12701 \| FLJ13990 \| FLJ37688 \| L44MT \| MRP-L44	mitochondrial ribosomal protein L44	Affinity Capture-MS	BioGRID	17353931
NFKBIA	IKBA \| MAD-3 \| NFKBI	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha	The amino terminus of Beta-Arr2 interacts with the carboxy terminus of I-kappa-B-alpha to prevent I-kappa-B-alpha phosphorylation and degradation.	BIND	15125834
NOLC1	KIAA0035 \| NOPP130 \| NOPP140 \| NS5ATP13 \| P130	nucleolar and coiled-body phosphoprotein 1	Affinity Capture-MS	BioGRID	17353931
NTS	NMN-125 \| NN \| NT \| NT/N \| NTS1	neurotensin	-	HPRD	12473660
NTSR1	NTR	neurotensin receptor 1 (high affinity)	-	HPRD	11279203
OPRD1	OPRD	opioid receptor, delta 1	-	HPRD,BioGRID	11259507
OXTR	OT-R	oxytocin receptor	-	HPRD	11279203
PDE4D	DPDE3 \| HSPDE4D \| PDE4DN2 \| STRK1	phosphodiesterase 4D, cAMP-specific (phosphodiesterase E3 dunce homolog, Drosophila)	PDE4D5 interacts with Beta-Arrestin 2.	BIND	14500724
PES1	PES	pescadillo homolog 1, containing BRCT domain (zebrafish)	Affinity Capture-MS	BioGRID	17353931
PTAFR	PAFR	platelet-activating factor receptor	-	HPRD,BioGRID	11729201
PTAFR	PAFR	platelet-activating factor receptor	-	HPRD	9037196
RAB5C	MGC117217 \| MGC138857 \| RAB5CL \| RABL	RAB5C, member RAS oncogene family	Affinity Capture-MS	BioGRID	17353931
RALGDS	FLJ20922 \| RGF \| RalGEF	ral guanine nucleotide dissociation stimulator	-	HPRD,BioGRID	12105416
RPL7L1	MGC62004 \| dJ475N16.4	ribosomal protein L7-like 1	Affinity Capture-MS	BioGRID	17353931
SLC9A5	NHE5	solute carrier family 9 (sodium/hydrogen exchanger), member 5	Beta-Arr2 interacts with NHE5.	BIND	15699339
SMARCC2	BAF170 \| CRACC2 \| Rsc8	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2	Two-hybrid	BioGRID	16169070
SMO	Gx \| SMOH	smoothened homolog (Drosophila)	Beta-arr2 interacts with Smo. This interaction was modeled on a demonstrated interaction between Beta-arr2 and Smo both from an unspecified species.	BIND	15618519
STC2	STC-2 \| STCRP	stanniocalcin 2	Two-hybrid	BioGRID	16169070
TCOF1	MFD1 \| treacle	Treacher Collins-Franceschetti syndrome 1	Affinity Capture-MS	BioGRID	17353931
TRH	MGC125964 \| MGC125965	thyrotropin-releasing hormone	-	HPRD	12473660

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG MAPK SIGNALING PATHWAY	267	205	All SZGR 2.0 genes in this pathway
KEGG CHEMOKINE SIGNALING PATHWAY	190	128	All SZGR 2.0 genes in this pathway
KEGG ENDOCYTOSIS	183	132	All SZGR 2.0 genes in this pathway
KEGG OLFACTORY TRANSDUCTION	389	85	All SZGR 2.0 genes in this pathway
PID WNT NONCANONICAL PATHWAY	32	26	All SZGR 2.0 genes in this pathway
PID NFKAPPAB ATYPICAL PATHWAY	17	15	All SZGR 2.0 genes in this pathway
PID ARF6 PATHWAY	35	27	All SZGR 2.0 genes in this pathway
PID TXA2PATHWAY	57	43	All SZGR 2.0 genes in this pathway
PID CXCR4 PATHWAY	102	78	All SZGR 2.0 genes in this pathway
PID ALK1 PATHWAY	26	21	All SZGR 2.0 genes in this pathway
PID NEPHRIN NEPH1 PATHWAY	31	24	All SZGR 2.0 genes in this pathway
PID IL8 CXCR2 PATHWAY	34	26	All SZGR 2.0 genes in this pathway
PID HEDGEHOG 2PATHWAY	22	17	All SZGR 2.0 genes in this pathway
PID HEDGEHOG GLI PATHWAY	48	35	All SZGR 2.0 genes in this pathway
PID IL8 CXCR1 PATHWAY	28	19	All SZGR 2.0 genes in this pathway
PID TGFBR PATHWAY	55	38	All SZGR 2.0 genes in this pathway
REACTOME ACTIVATED NOTCH1 TRANSMITS SIGNAL TO THE NUCLEUS	27	18	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY NOTCH1	70	46	All SZGR 2.0 genes in this pathway
REACTOME THROMBIN SIGNALLING THROUGH PROTEINASE ACTIVATED RECEPTORS PARS	32	20	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY NOTCH	103	64	All SZGR 2.0 genes in this pathway
REACTOME HEMOSTASIS	466	331	All SZGR 2.0 genes in this pathway
REACTOME PLATELET ACTIVATION SIGNALING AND AGGREGATION	208	138	All SZGR 2.0 genes in this pathway
PRAMOONJAGO SOX4 TARGETS DN	51	35	All SZGR 2.0 genes in this pathway
LIU CMYB TARGETS UP	165	106	All SZGR 2.0 genes in this pathway
RODRIGUES NTN1 TARGETS DN	158	102	All SZGR 2.0 genes in this pathway
WANG CLIM2 TARGETS UP	269	146	All SZGR 2.0 genes in this pathway
CHOW RASSF1 TARGETS UP	27	17	All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 1 DN	378	231	All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 3 UP	329	196	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN	1781	1082	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 UP	309	199	All SZGR 2.0 genes in this pathway
BENPORATH MYC MAX TARGETS	775	494	All SZGR 2.0 genes in this pathway
PETROVA ENDOTHELIUM LYMPHATIC VS BLOOD UP	131	87	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 12HR UP	111	68	All SZGR 2.0 genes in this pathway
BASSO HAIRY CELL LEUKEMIA DN	80	66	All SZGR 2.0 genes in this pathway
WILENSKY RESPONSE TO DARAPLADIB	29	20	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP	1305	895	All SZGR 2.0 genes in this pathway
CHEN METABOLIC SYNDROM NETWORK	1210	725	All SZGR 2.0 genes in this pathway
DANG BOUND BY MYC	1103	714	All SZGR 2.0 genes in this pathway
KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP	756	494	All SZGR 2.0 genes in this pathway
KIM ALL DISORDERS DURATION CORR DN	146	90	All SZGR 2.0 genes in this pathway
PILON KLF1 TARGETS DN	1972	1213	All SZGR 2.0 genes in this pathway
HOLLEMAN ASPARAGINASE RESISTANCE B ALL DN	15	10	All SZGR 2.0 genes in this pathway
HOLLEMAN ASPARAGINASE RESISTANCE ALL DN	25	14	All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY	1839	928	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-365	192	199	1A,m8	hsa-miR-365	UAAUGCCCCUAAAAAUCCUUAU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: ARRB2