Gene Page: ARRB2
Summary ?
GeneID | 409 |
Symbol | ARRB2 |
Synonyms | ARB2|ARR2|BARR2 |
Description | arrestin, beta 2 |
Reference | MIM:107941|HGNC:HGNC:712|Ensembl:ENSG00000141480|HPRD:00147|Vega:OTTHUMG00000090759 |
Gene type | protein-coding |
Map location | 17p13 |
Pascal p-value | 0.271 |
Sherlock p-value | 0.065 |
Fetal beta | -0.516 |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DNM:Guipponi_2014 | Whole Exome Sequencing analysis | 49 DNMs were identified by comparing the exome of 53 individuals with sporadic SCZ and of their non-affected parents | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
DNM table
Gene | Chromosome | Position | Ref | Alt | Transcript | AA change | Mutation type | Sift | CG46 | Trait | Study |
---|---|---|---|---|---|---|---|---|---|---|---|
ARRB2 | G | A | NM_001257331 | p.P161P | synonymous | NA | NA | Schizophrenia | DNM:Guipponi_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
ADAM23 | 0.91 | 0.89 |
ATP2A2 | 0.91 | 0.91 |
AAK1 | 0.90 | 0.87 |
MAP7D2 | 0.90 | 0.87 |
KCNC2 | 0.88 | 0.74 |
PPM1H | 0.88 | 0.83 |
KCND3 | 0.88 | 0.87 |
ANKRD34C | 0.88 | 0.59 |
CDS1 | 0.88 | 0.85 |
PAQR9 | 0.87 | 0.84 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
RAB13 | -0.40 | -0.53 |
EFEMP2 | -0.40 | -0.41 |
RAB34 | -0.39 | -0.49 |
RPL35 | -0.38 | -0.43 |
BCL7C | -0.38 | -0.44 |
GTF3C6 | -0.38 | -0.33 |
NME4 | -0.37 | -0.46 |
C1orf61 | -0.37 | -0.52 |
AC006276.2 | -0.37 | -0.35 |
RPL31 | -0.36 | -0.37 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005515 | protein binding | IEA | - | |
GO:0005515 | protein binding | IPI | 17353931 |17620599 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0001932 | regulation of protein amino acid phosphorylation | IEA | - | |
GO:0007165 | signal transduction | IEA | - | |
GO:0007179 | transforming growth factor beta receptor signaling pathway | IDA | 12958365 | |
GO:0008277 | regulation of G-protein coupled receptor protein signaling pathway | IEA | - | |
GO:0007600 | sensory perception | IEA | - | |
GO:0031623 | receptor internalization | IDA | 12958365 | |
GO:0050896 | response to stimulus | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005622 | intracellular | IEA | - | |
GO:0005634 | nucleus | IEA | - | |
GO:0005737 | cytoplasm | IEA | - | |
GO:0005886 | plasma membrane | TAS | 9346876 | |
GO:0031410 | cytoplasmic vesicle | IDA | 12958365 |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
AGTR1 | AG2S | AGTR1A | AGTR1B | AT1 | AT1B | AT1R | AT2R1 | AT2R1A | AT2R1B | HAT1R | angiotensin II receptor, type 1 | - | HPRD | 11279203 |
AP1B1 | ADTB1 | AP105A | BAM22 | CLAPB2 | adaptor-related protein complex 1, beta 1 subunit | - | HPRD | 10097102 |12070169 |
AP2B1 | ADTB2 | AP105B | AP2-BETA | CLAPB1 | DKFZp781K0743 | adaptor-related protein complex 2, beta 1 subunit | Reconstituted Complex Two-hybrid | BioGRID | 10097102 |12070169 |
AP3B1 | ADTB3 | ADTB3A | HPS | HPS2 | PE | adaptor-related protein complex 3, beta 1 subunit | Affinity Capture-MS | BioGRID | 17353931 |
ARF6 | DKFZp564M0264 | ADP-ribosylation factor 6 | - | HPRD,BioGRID | 11533043 |11867621 |
ARRB1 | ARB1 | ARR1 | arrestin, beta 1 | Affinity Capture-MS | BioGRID | 17353931 |
AVPR2 | ADHR | DI1 | DIR | DIR3 | MGC126533 | MGC138386 | NDI | V2R | arginine vasopressin receptor 2 | - | HPRD,BioGRID | 12473660 |
BOP1 | KIAA0124 | block of proliferation 1 | Affinity Capture-MS | BioGRID | 17353931 |
CLTC | CHC | CHC17 | CLH-17 | CLTCL2 | Hc | KIAA0034 | clathrin, heavy chain (Hc) | - | HPRD | 10097102 |
CYTH2 | ARNO | CTS18 | CTS18.1 | PSCD2 | PSCD2L | SEC7L | Sec7p-L | Sec7p-like | cytohesin 2 | - | HPRD,BioGRID | 11533043 |
DDX27 | DKFZp667N057 | FLJ12917 | FLJ20596 | FLJ22238 | HSPC259 | MGC1018 | MGC163147 | PP3241 | RHLP | Rrp3p | dJ686N3.1 | DEAD (Asp-Glu-Ala-Asp) box polypeptide 27 | Affinity Capture-MS | BioGRID | 17353931 |
FBL | FIB | FLRN | RNU3IP1 | fibrillarin | Affinity Capture-MS | BioGRID | 17353931 |
KPNA3 | IPOA4 | SRP1gamma | SRP4 | hSRP1 | karyopherin alpha 3 (importin alpha 4) | Affinity Capture-MS | BioGRID | 17353931 |
KPNA4 | IPOA3 | MGC12217 | MGC26703 | QIP1 | SRP3 | karyopherin alpha 4 (importin alpha 3) | Affinity Capture-MS | BioGRID | 17353931 |
LHCGR | FLJ41504 | LCGR | LGR2 | LH/CG-R | LH/CGR | LHR | LHRHR | LSH-R | luteinizing hormone/choriogonadotropin receptor | Reconstituted Complex | BioGRID | 11867621 |
MAP2K4 | JNKK | JNKK1 | MAPKK4 | MEK4 | MKK4 | PRKMK4 | SEK1 | SERK1 | mitogen-activated protein kinase kinase 4 | - | HPRD,BioGRID | 11090355 |
MAP3K5 | ASK1 | MAPKKK5 | MEKK5 | mitogen-activated protein kinase kinase kinase 5 | Affinity Capture-Western | BioGRID | 11090355 |
MAP3K5 | ASK1 | MAPKKK5 | MEKK5 | mitogen-activated protein kinase kinase kinase 5 | - | HPRD | 11356842 |
MAPK10 | FLJ12099 | FLJ33785 | JNK3 | JNK3A | MGC50974 | PRKM10 | p493F12 | p54bSAPK | mitogen-activated protein kinase 10 | - | HPRD,BioGRID | 11090355 |11356842 |
MAPK10 | FLJ12099 | FLJ33785 | JNK3 | JNK3A | MGC50974 | PRKM10 | p493F12 | p54bSAPK | mitogen-activated protein kinase 10 | - | HPRD | 11090355 |
MAPK3 | ERK1 | HS44KDAP | HUMKER1A | MGC20180 | P44ERK1 | P44MAPK | PRKM3 | mitogen-activated protein kinase 3 | Affinity Capture-Western | BioGRID | 12473660 |
MDM2 | HDMX | MGC71221 | hdm2 | Mdm2 p53 binding protein homolog (mouse) | - | HPRD,BioGRID | 12488444 |12538596 |
MDM2 | HDMX | MGC71221 | hdm2 | Mdm2 p53 binding protein homolog (mouse) | - | HPRD | 11588219 |12488444 |12538596|12488444 |12538596 |
MED8 | ARC32 | MGC17544 | MGC19641 | mediator complex subunit 8 | Two-hybrid | BioGRID | 16169070 |
MRPL43 | MGC17989 | MGC48892 | bMRP36a | mitochondrial ribosomal protein L43 | Affinity Capture-MS | BioGRID | 17353931 |
MRPL44 | FLJ12701 | FLJ13990 | FLJ37688 | L44MT | MRP-L44 | mitochondrial ribosomal protein L44 | Affinity Capture-MS | BioGRID | 17353931 |
NFKBIA | IKBA | MAD-3 | NFKBI | nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha | The amino terminus of Beta-Arr2 interacts with the carboxy terminus of I-kappa-B-alpha to prevent I-kappa-B-alpha phosphorylation and degradation. | BIND | 15125834 |
NOLC1 | KIAA0035 | NOPP130 | NOPP140 | NS5ATP13 | P130 | nucleolar and coiled-body phosphoprotein 1 | Affinity Capture-MS | BioGRID | 17353931 |
NTS | NMN-125 | NN | NT | NT/N | NTS1 | neurotensin | - | HPRD | 12473660 |
NTSR1 | NTR | neurotensin receptor 1 (high affinity) | - | HPRD | 11279203 |
OPRD1 | OPRD | opioid receptor, delta 1 | - | HPRD,BioGRID | 11259507 |
OXTR | OT-R | oxytocin receptor | - | HPRD | 11279203 |
PDE4D | DPDE3 | HSPDE4D | PDE4DN2 | STRK1 | phosphodiesterase 4D, cAMP-specific (phosphodiesterase E3 dunce homolog, Drosophila) | PDE4D5 interacts with Beta-Arrestin 2. | BIND | 14500724 |
PES1 | PES | pescadillo homolog 1, containing BRCT domain (zebrafish) | Affinity Capture-MS | BioGRID | 17353931 |
PTAFR | PAFR | platelet-activating factor receptor | - | HPRD,BioGRID | 11729201 |
PTAFR | PAFR | platelet-activating factor receptor | - | HPRD | 9037196 |
RAB5C | MGC117217 | MGC138857 | RAB5CL | RABL | RAB5C, member RAS oncogene family | Affinity Capture-MS | BioGRID | 17353931 |
RALGDS | FLJ20922 | RGF | RalGEF | ral guanine nucleotide dissociation stimulator | - | HPRD,BioGRID | 12105416 |
RPL7L1 | MGC62004 | dJ475N16.4 | ribosomal protein L7-like 1 | Affinity Capture-MS | BioGRID | 17353931 |
SLC9A5 | NHE5 | solute carrier family 9 (sodium/hydrogen exchanger), member 5 | Beta-Arr2 interacts with NHE5. | BIND | 15699339 |
SMARCC2 | BAF170 | CRACC2 | Rsc8 | SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2 | Two-hybrid | BioGRID | 16169070 |
SMO | Gx | SMOH | smoothened homolog (Drosophila) | Beta-arr2 interacts with Smo. This interaction was modeled on a demonstrated interaction between Beta-arr2 and Smo both from an unspecified species. | BIND | 15618519 |
STC2 | STC-2 | STCRP | stanniocalcin 2 | Two-hybrid | BioGRID | 16169070 |
TCOF1 | MFD1 | treacle | Treacher Collins-Franceschetti syndrome 1 | Affinity Capture-MS | BioGRID | 17353931 |
TRH | MGC125964 | MGC125965 | thyrotropin-releasing hormone | - | HPRD | 12473660 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG MAPK SIGNALING PATHWAY | 267 | 205 | All SZGR 2.0 genes in this pathway |
KEGG CHEMOKINE SIGNALING PATHWAY | 190 | 128 | All SZGR 2.0 genes in this pathway |
KEGG ENDOCYTOSIS | 183 | 132 | All SZGR 2.0 genes in this pathway |
KEGG OLFACTORY TRANSDUCTION | 389 | 85 | All SZGR 2.0 genes in this pathway |
PID WNT NONCANONICAL PATHWAY | 32 | 26 | All SZGR 2.0 genes in this pathway |
PID NFKAPPAB ATYPICAL PATHWAY | 17 | 15 | All SZGR 2.0 genes in this pathway |
PID ARF6 PATHWAY | 35 | 27 | All SZGR 2.0 genes in this pathway |
PID TXA2PATHWAY | 57 | 43 | All SZGR 2.0 genes in this pathway |
PID CXCR4 PATHWAY | 102 | 78 | All SZGR 2.0 genes in this pathway |
PID ALK1 PATHWAY | 26 | 21 | All SZGR 2.0 genes in this pathway |
PID NEPHRIN NEPH1 PATHWAY | 31 | 24 | All SZGR 2.0 genes in this pathway |
PID IL8 CXCR2 PATHWAY | 34 | 26 | All SZGR 2.0 genes in this pathway |
PID HEDGEHOG 2PATHWAY | 22 | 17 | All SZGR 2.0 genes in this pathway |
PID HEDGEHOG GLI PATHWAY | 48 | 35 | All SZGR 2.0 genes in this pathway |
PID IL8 CXCR1 PATHWAY | 28 | 19 | All SZGR 2.0 genes in this pathway |
PID TGFBR PATHWAY | 55 | 38 | All SZGR 2.0 genes in this pathway |
REACTOME ACTIVATED NOTCH1 TRANSMITS SIGNAL TO THE NUCLEUS | 27 | 18 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY NOTCH1 | 70 | 46 | All SZGR 2.0 genes in this pathway |
REACTOME THROMBIN SIGNALLING THROUGH PROTEINASE ACTIVATED RECEPTORS PARS | 32 | 20 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY NOTCH | 103 | 64 | All SZGR 2.0 genes in this pathway |
REACTOME HEMOSTASIS | 466 | 331 | All SZGR 2.0 genes in this pathway |
REACTOME PLATELET ACTIVATION SIGNALING AND AGGREGATION | 208 | 138 | All SZGR 2.0 genes in this pathway |
PRAMOONJAGO SOX4 TARGETS DN | 51 | 35 | All SZGR 2.0 genes in this pathway |
LIU CMYB TARGETS UP | 165 | 106 | All SZGR 2.0 genes in this pathway |
RODRIGUES NTN1 TARGETS DN | 158 | 102 | All SZGR 2.0 genes in this pathway |
WANG CLIM2 TARGETS UP | 269 | 146 | All SZGR 2.0 genes in this pathway |
CHOW RASSF1 TARGETS UP | 27 | 17 | All SZGR 2.0 genes in this pathway |
LINDGREN BLADDER CANCER CLUSTER 1 DN | 378 | 231 | All SZGR 2.0 genes in this pathway |
LINDGREN BLADDER CANCER CLUSTER 3 UP | 329 | 196 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
DACOSTA UV RESPONSE VIA ERCC3 UP | 309 | 199 | All SZGR 2.0 genes in this pathway |
BENPORATH MYC MAX TARGETS | 775 | 494 | All SZGR 2.0 genes in this pathway |
PETROVA ENDOTHELIUM LYMPHATIC VS BLOOD UP | 131 | 87 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 12HR UP | 111 | 68 | All SZGR 2.0 genes in this pathway |
BASSO HAIRY CELL LEUKEMIA DN | 80 | 66 | All SZGR 2.0 genes in this pathway |
WILENSKY RESPONSE TO DARAPLADIB | 29 | 20 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
CHEN METABOLIC SYNDROM NETWORK | 1210 | 725 | All SZGR 2.0 genes in this pathway |
DANG BOUND BY MYC | 1103 | 714 | All SZGR 2.0 genes in this pathway |
KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP | 756 | 494 | All SZGR 2.0 genes in this pathway |
KIM ALL DISORDERS DURATION CORR DN | 146 | 90 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
HOLLEMAN ASPARAGINASE RESISTANCE B ALL DN | 15 | 10 | All SZGR 2.0 genes in this pathway |
HOLLEMAN ASPARAGINASE RESISTANCE ALL DN | 25 | 14 | All SZGR 2.0 genes in this pathway |
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-365 | 192 | 199 | 1A,m8 | hsa-miR-365 | UAAUGCCCCUAAAAAUCCUUAU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.