Gene Page: MYO1D
Summary ?
GeneID | 4642 |
Symbol | MYO1D |
Synonyms | PPP1R108|myr4 |
Description | myosin ID |
Reference | MIM:606539|HGNC:HGNC:7598|Ensembl:ENSG00000176658|HPRD:07581|Vega:OTTHUMG00000179636 |
Gene type | protein-coding |
Map location | 17q11.2 |
Pascal p-value | 0.05 |
Support | G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet Ascano FMRP targets |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
TM9SF1 | 0.83 | 0.79 |
HEATR2 | 0.80 | 0.78 |
ERBB2 | 0.80 | 0.73 |
CMTM3 | 0.79 | 0.65 |
CHST14 | 0.79 | 0.76 |
MEST | 0.79 | 0.73 |
TCTN3 | 0.78 | 0.71 |
MMP2 | 0.78 | 0.73 |
DDR1 | 0.78 | 0.72 |
GLB1 | 0.77 | 0.76 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
AF347015.21 | -0.48 | -0.55 |
MT-CO2 | -0.47 | -0.53 |
AF347015.27 | -0.46 | -0.51 |
AF347015.8 | -0.44 | -0.50 |
AF347015.31 | -0.44 | -0.49 |
AF347015.33 | -0.44 | -0.48 |
C5orf53 | -0.43 | -0.45 |
MT-CYB | -0.42 | -0.48 |
AC098691.2 | -0.41 | -0.45 |
AF347015.2 | -0.39 | -0.46 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0000166 | nucleotide binding | IEA | - | |
GO:0003779 | actin binding | IEA | - | |
GO:0003774 | motor activity | IEA | - | |
GO:0005516 | calmodulin binding | IEA | - | |
GO:0005524 | ATP binding | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0016459 | myosin complex | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
PARENT MTOR SIGNALING UP | 567 | 375 | All SZGR 2.0 genes in this pathway |
SENGUPTA NASOPHARYNGEAL CARCINOMA DN | 349 | 157 | All SZGR 2.0 genes in this pathway |
TURASHVILI BREAST NORMAL DUCTAL VS LOBULAR UP | 68 | 40 | All SZGR 2.0 genes in this pathway |
CORRE MULTIPLE MYELOMA UP | 74 | 45 | All SZGR 2.0 genes in this pathway |
CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL UP | 450 | 256 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA UP | 1821 | 933 | All SZGR 2.0 genes in this pathway |
RODRIGUES THYROID CARCINOMA DN | 77 | 52 | All SZGR 2.0 genes in this pathway |
COLDREN GEFITINIB RESISTANCE DN | 230 | 115 | All SZGR 2.0 genes in this pathway |
DELYS THYROID CANCER UP | 443 | 294 | All SZGR 2.0 genes in this pathway |
GAUSSMANN MLL AF4 FUSION TARGETS A DN | 90 | 61 | All SZGR 2.0 genes in this pathway |
BERENJENO TRANSFORMED BY RHOA DN | 394 | 258 | All SZGR 2.0 genes in this pathway |
PATTERSON DOCETAXEL RESISTANCE | 29 | 20 | All SZGR 2.0 genes in this pathway |
NUYTTEN NIPP1 TARGETS DN | 848 | 527 | All SZGR 2.0 genes in this pathway |
PASQUALUCCI LYMPHOMA BY GC STAGE UP | 283 | 177 | All SZGR 2.0 genes in this pathway |
NIKOLSKY BREAST CANCER 17Q11 Q21 AMPLICON | 133 | 78 | All SZGR 2.0 genes in this pathway |
GOTTWEIN TARGETS OF KSHV MIR K12 11 | 63 | 45 | All SZGR 2.0 genes in this pathway |
ONDER CDH1 TARGETS 2 DN | 464 | 276 | All SZGR 2.0 genes in this pathway |
LE EGR2 TARGETS DN | 108 | 84 | All SZGR 2.0 genes in this pathway |
SASAKI ADULT T CELL LEUKEMIA | 176 | 122 | All SZGR 2.0 genes in this pathway |
KANG IMMORTALIZED BY TERT DN | 102 | 67 | All SZGR 2.0 genes in this pathway |
KUMAR TARGETS OF MLL AF9 FUSION | 405 | 264 | All SZGR 2.0 genes in this pathway |
CUI TCF21 TARGETS 2 DN | 830 | 547 | All SZGR 2.0 genes in this pathway |
DASU IL6 SIGNALING SCAR UP | 30 | 21 | All SZGR 2.0 genes in this pathway |
KONDO EZH2 TARGETS | 245 | 148 | All SZGR 2.0 genes in this pathway |
HAN SATB1 TARGETS DN | 442 | 275 | All SZGR 2.0 genes in this pathway |
MEISSNER NPC HCP WITH H3K4ME3 AND H3K27ME3 | 142 | 103 | All SZGR 2.0 genes in this pathway |
PLASARI TGFB1 TARGETS 10HR UP | 199 | 143 | All SZGR 2.0 genes in this pathway |
PEDRIOLI MIR31 TARGETS DN | 418 | 245 | All SZGR 2.0 genes in this pathway |
DURAND STROMA S UP | 297 | 194 | All SZGR 2.0 genes in this pathway |
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY | 1725 | 838 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-137 | 2129 | 2135 | 1A | hsa-miR-137 | UAUUGCUUAAGAAUACGCGUAG |
miR-142-5p | 2092 | 2098 | m8 | hsa-miR-142-5p | CAUAAAGUAGAAAGCACUAC |
miR-155 | 2137 | 2144 | 1A,m8 | hsa-miR-155 | UUAAUGCUAAUCGUGAUAGGGG |
miR-17-5p/20/93.mr/106/519.d | 1890 | 1896 | m8 | hsa-miR-17-5p | CAAAGUGCUUACAGUGCAGGUAGU |
hsa-miR-20abrain | UAAAGUGCUUAUAGUGCAGGUAG | ||||
hsa-miR-106a | AAAAGUGCUUACAGUGCAGGUAGC | ||||
hsa-miR-106bSZ | UAAAGUGCUGACAGUGCAGAU | ||||
hsa-miR-20bSZ | CAAAGUGCUCAUAGUGCAGGUAG | ||||
hsa-miR-519d | CAAAGUGCCUCCCUUUAGAGUGU | ||||
miR-182 | 1753 | 1759 | 1A | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
miR-335 | 2028 | 2034 | 1A | hsa-miR-335brain | UCAAGAGCAAUAACGAAAAAUGU |
miR-9 | 208 | 214 | 1A | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
miR-96 | 1753 | 1759 | 1A | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.