Gene Page: MYO9B
Summary ?
| GeneID | 4650 |
| Symbol | MYO9B |
| Synonyms | CELIAC4|MYR5 |
| Description | myosin IXB |
| Reference | MIM:602129|HGNC:HGNC:7609|Ensembl:ENSG00000099331|HPRD:03677|Vega:OTTHUMG00000182707 |
| Gene type | protein-coding |
| Map location | 19p13.1 |
| Pascal p-value | 0.288 |
| Sherlock p-value | 0.386 |
| Fetal beta | 0.727 |
| eGene | Myers' cis & trans Meta |
| Support | Ascano FMRP targets |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Association | A combined odds ratio method (Sun et al. 2008), association studies | 1 | Link to SZGene |
| Expression | Meta-analysis of gene expression | P value: 1.36 | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg25290657 | 19 | 17186505 | HAUS8;MYO9B | 4.545E-4 | -0.353 | 0.045 | DMG:Wockner_2014 |
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs7830259 | chr8 | 14087643 | MYO9B | 4650 | 0.03 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| PWP1 | 0.95 | 0.95 |
| TSR1 | 0.94 | 0.94 |
| THUMPD3 | 0.93 | 0.93 |
| CAPN7 | 0.93 | 0.94 |
| C17orf71 | 0.93 | 0.94 |
| PSPC1 | 0.93 | 0.94 |
| PLRG1 | 0.93 | 0.93 |
| SF3A3 | 0.92 | 0.93 |
| SMARCA1 | 0.92 | 0.93 |
| DIS3 | 0.92 | 0.92 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| MT-CO2 | -0.82 | -0.89 |
| AF347015.31 | -0.82 | -0.88 |
| AF347015.27 | -0.79 | -0.86 |
| MT-CYB | -0.79 | -0.87 |
| AF347015.33 | -0.79 | -0.86 |
| AF347015.8 | -0.78 | -0.88 |
| IFI27 | -0.76 | -0.83 |
| AF347015.21 | -0.75 | -0.86 |
| FXYD1 | -0.75 | -0.83 |
| AF347015.15 | -0.75 | -0.86 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0000146 | microfilament motor activity | IDA | 9490638 |11901422 |16616011 | |
| GO:0000146 | microfilament motor activity | TAS | 8907710 | |
| GO:0000166 | nucleotide binding | IEA | - | |
| GO:0005100 | Rho GTPase activator activity | IDA | 9490638 |15644318 | |
| GO:0003779 | actin binding | IDA | 9490638 |16338935 |16616011 | |
| GO:0003774 | motor activity | IEA | - | |
| GO:0005096 | GTPase activator activity | IEA | - | |
| GO:0005516 | calmodulin binding | IDA | 9490638 |16338935 | |
| GO:0005524 | ATP binding | IDA | 16338935 | |
| GO:0005524 | ATP binding | IEA | - | |
| GO:0008270 | zinc ion binding | IEA | - | |
| GO:0016887 | ATPase activity | IDA | 16338935 | |
| GO:0042803 | protein homodimerization activity | IDA | 11901422 | |
| GO:0019992 | diacylglycerol binding | IEA | - | |
| GO:0046872 | metal ion binding | IEA | - | |
| GO:0043531 | ADP binding | IDA | 16338935 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007242 | intracellular signaling cascade | IEA | - | |
| GO:0030048 | actin filament-based movement | TAS | 8907710 | |
| GO:0032011 | ARF protein signal transduction | IDA | 15644318 | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005622 | intracellular | IEA | - | |
| GO:0005737 | cytoplasm | IDA | 8907710 | |
| GO:0005938 | cell cortex | IDA | 8907710 | |
| GO:0048471 | perinuclear region of cytoplasm | IDA | 8907710 | |
| GO:0016459 | myosin complex | IEA | - | |
| GO:0031941 | filamentous actin | IDA | 8907710 |16338935 |16616011 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| PID RHOA REG PATHWAY | 46 | 30 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNALING BY RHO GTPASES | 113 | 81 | All SZGR 2.0 genes in this pathway |
| PARENT MTOR SIGNALING UP | 567 | 375 | All SZGR 2.0 genes in this pathway |
| GAZDA DIAMOND BLACKFAN ANEMIA ERYTHROID DN | 493 | 298 | All SZGR 2.0 genes in this pathway |
| HUTTMANN B CLL POOR SURVIVAL UP | 276 | 187 | All SZGR 2.0 genes in this pathway |
| GINESTIER BREAST CANCER ZNF217 AMPLIFIED DN | 335 | 193 | All SZGR 2.0 genes in this pathway |
| GINESTIER BREAST CANCER 20Q13 AMPLIFICATION DN | 180 | 101 | All SZGR 2.0 genes in this pathway |
| DACOSTA UV RESPONSE VIA ERCC3 XPCS DN | 88 | 71 | All SZGR 2.0 genes in this pathway |
| SCHLOSSER SERUM RESPONSE UP | 134 | 93 | All SZGR 2.0 genes in this pathway |
| DACOSTA UV RESPONSE VIA ERCC3 DN | 855 | 609 | All SZGR 2.0 genes in this pathway |
| SHETH LIVER CANCER VS TXNIP LOSS PAM2 | 153 | 102 | All SZGR 2.0 genes in this pathway |
| AMIT EGF RESPONSE 480 HELA | 164 | 118 | All SZGR 2.0 genes in this pathway |
| NIKOLSKY MUTATED AND AMPLIFIED IN BREAST CANCER | 94 | 60 | All SZGR 2.0 genes in this pathway |
| ASTON MAJOR DEPRESSIVE DISORDER DN | 160 | 110 | All SZGR 2.0 genes in this pathway |
| THEILGAARD NEUTROPHIL AT SKIN WOUND DN | 225 | 163 | All SZGR 2.0 genes in this pathway |
| FAELT B CLL WITH VH3 21 UP | 44 | 30 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
| MARIADASON REGULATED BY HISTONE ACETYLATION UP | 83 | 49 | All SZGR 2.0 genes in this pathway |
| DEBIASI APOPTOSIS BY REOVIRUS INFECTION DN | 287 | 208 | All SZGR 2.0 genes in this pathway |
| MARSON BOUND BY E2F4 UNSTIMULATED | 728 | 415 | All SZGR 2.0 genes in this pathway |
| HELLER SILENCED BY METHYLATION UP | 282 | 183 | All SZGR 2.0 genes in this pathway |
| HELLER HDAC TARGETS UP | 317 | 208 | All SZGR 2.0 genes in this pathway |
| HELLER HDAC TARGETS SILENCED BY METHYLATION UP | 461 | 298 | All SZGR 2.0 genes in this pathway |
| MCCABE BOUND BY HOXC6 | 469 | 239 | All SZGR 2.0 genes in this pathway |
| BONOME OVARIAN CANCER SURVIVAL SUBOPTIMAL DEBULKING | 510 | 309 | All SZGR 2.0 genes in this pathway |
| WEST ADRENOCORTICAL TUMOR UP | 294 | 199 | All SZGR 2.0 genes in this pathway |
| CHEN METABOLIC SYNDROM NETWORK | 1210 | 725 | All SZGR 2.0 genes in this pathway |
| MILI PSEUDOPODIA CHEMOTAXIS DN | 457 | 302 | All SZGR 2.0 genes in this pathway |
| MARTENS BOUND BY PML RARA FUSION | 456 | 287 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-124.1 | 328 | 334 | 1A | hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.