Gene Page: NDUFA2
Summary ?
| GeneID | 4695 |
| Symbol | NDUFA2 |
| Synonyms | B8|CD14|CIB8 |
| Description | NADH:ubiquinone oxidoreductase subunit A2 |
| Reference | MIM:602137|HGNC:HGNC:7685|Ensembl:ENSG00000131495|HPRD:11883|Vega:OTTHUMG00000129505 |
| Gene type | protein-coding |
| Map location | 5q31.2 |
| Pascal p-value | 1.577E-5 |
| Sherlock p-value | 0.842 |
| Fetal beta | -0.736 |
| DMG | 1 (# studies) |
| eGene | Meta |
| Support | CompositeSet |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
| GSMA_I | Genome scan meta-analysis | Psr: 0.0032 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg20713439 | 5 | 140027088 | NDUFA2 | 5.27E-8 | -0.008 | 1.38E-5 | DMG:Jaffe_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0008137 | NADH dehydrogenase (ubiquinone) activity | NAS | 9878551 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006120 | mitochondrial electron transport, NADH to ubiquinone | NAS | 9878551 | |
| GO:0006810 | transport | IEA | - | |
| GO:0022900 | electron transport chain | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005739 | mitochondrion | IEA | - | |
| GO:0005747 | mitochondrial respiratory chain complex I | IDA | 17209039 | |
| GO:0005747 | mitochondrial respiratory chain complex I | NAS | 9878551 | |
| GO:0016020 | membrane | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG OXIDATIVE PHOSPHORYLATION | 135 | 73 | All SZGR 2.0 genes in this pathway |
| KEGG ALZHEIMERS DISEASE | 169 | 110 | All SZGR 2.0 genes in this pathway |
| KEGG PARKINSONS DISEASE | 133 | 78 | All SZGR 2.0 genes in this pathway |
| KEGG HUNTINGTONS DISEASE | 185 | 109 | All SZGR 2.0 genes in this pathway |
| REACTOME TCA CYCLE AND RESPIRATORY ELECTRON TRANSPORT | 141 | 85 | All SZGR 2.0 genes in this pathway |
| REACTOME RESPIRATORY ELECTRON TRANSPORT | 79 | 44 | All SZGR 2.0 genes in this pathway |
| REACTOME RESPIRATORY ELECTRON TRANSPORT ATP SYNTHESIS BY CHEMIOSMOTIC COUPLING AND HEAT PRODUCTION BY UNCOUPLING PROTEINS | 98 | 56 | All SZGR 2.0 genes in this pathway |
| KIM RESPONSE TO TSA AND DECITABINE UP | 129 | 73 | All SZGR 2.0 genes in this pathway |
| FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS UP | 579 | 346 | All SZGR 2.0 genes in this pathway |
| TIEN INTESTINE PROBIOTICS 24HR UP | 557 | 331 | All SZGR 2.0 genes in this pathway |
| CONCANNON APOPTOSIS BY EPOXOMICIN DN | 172 | 112 | All SZGR 2.0 genes in this pathway |
| APPIERTO RESPONSE TO FENRETINIDE DN | 51 | 35 | All SZGR 2.0 genes in this pathway |
| SCHLOSSER SERUM RESPONSE DN | 712 | 443 | All SZGR 2.0 genes in this pathway |
| DAIRKEE TERT TARGETS UP | 380 | 213 | All SZGR 2.0 genes in this pathway |
| SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN UP | 479 | 299 | All SZGR 2.0 genes in this pathway |
| BENPORATH SOX2 TARGETS | 734 | 436 | All SZGR 2.0 genes in this pathway |
| BENPORATH MYC MAX TARGETS | 775 | 494 | All SZGR 2.0 genes in this pathway |
| STARK PREFRONTAL CORTEX 22Q11 DELETION DN | 517 | 309 | All SZGR 2.0 genes in this pathway |
| MOOTHA VOXPHOS | 87 | 51 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
| MARTINEZ RESPONSE TO TRABECTEDIN UP | 71 | 49 | All SZGR 2.0 genes in this pathway |
| MARTINEZ RB1 TARGETS UP | 673 | 430 | All SZGR 2.0 genes in this pathway |
| MARTINEZ TP53 TARGETS DN | 593 | 372 | All SZGR 2.0 genes in this pathway |
| MARTINEZ RB1 AND TP53 TARGETS DN | 591 | 366 | All SZGR 2.0 genes in this pathway |
| OUILLETTE CLL 13Q14 DELETION DN | 60 | 38 | All SZGR 2.0 genes in this pathway |
| ACEVEDO METHYLATED IN LIVER CANCER DN | 940 | 425 | All SZGR 2.0 genes in this pathway |
| BOCHKIS FOXA2 TARGETS | 425 | 261 | All SZGR 2.0 genes in this pathway |
| BLUM RESPONSE TO SALIRASIB DN | 342 | 220 | All SZGR 2.0 genes in this pathway |
| MOOTHA HUMAN MITODB 6 2002 | 429 | 260 | All SZGR 2.0 genes in this pathway |
| MOOTHA MITOCHONDRIA | 447 | 277 | All SZGR 2.0 genes in this pathway |
| YAGI AML WITH T 8 21 TRANSLOCATION | 368 | 247 | All SZGR 2.0 genes in this pathway |
| DANG BOUND BY MYC | 1103 | 714 | All SZGR 2.0 genes in this pathway |
| YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 13 | 172 | 107 | All SZGR 2.0 genes in this pathway |
| WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D | 658 | 397 | All SZGR 2.0 genes in this pathway |
| YANG BCL3 TARGETS UP | 364 | 236 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-421 | 169 | 175 | 1A | hsa-miR-421 | GGCCUCAUUAAAUGUUUGUUG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.