SZGR2

Summary ?

GeneID	4986
Symbol	OPRK1
Synonyms	K-OR-1\|KOR\|KOR-1\|OPRK
Description	opioid receptor, kappa 1
Reference	MIM:165196\|HGNC:HGNC:8154\|Ensembl:ENSG00000082556\|HPRD:01309\|Vega:OTTHUMG00000164276
Gene type	protein-coding
Map location	8q11.2
Pascal p-value	0.939
DMG	1 (# studies)
eGene	Cerebellar Hemisphere Meta
Support	GPCR SIGNALLING

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	1
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg09999109	8	54164310	OPRK1	4.82E-7	-0.392	0.006	DMG:Wockner_2014

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
YIPF3	0.91	0.88
PSMF1	0.89	0.86
PSMD3	0.89	0.88
DDOST	0.89	0.89
ERAL1	0.89	0.85
EIF2B2	0.89	0.84
TRAP1	0.88	0.84
EIF3I	0.88	0.86
PSMC4	0.88	0.85
DCTN2	0.88	0.85

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
MT-CO2	-0.78	-0.77
AF347015.31	-0.77	-0.77
AF347015.8	-0.76	-0.77
MT-CYB	-0.75	-0.77
AF347015.33	-0.74	-0.76
AF347015.21	-0.74	-0.78
AF347015.2	-0.74	-0.77
AF347015.27	-0.73	-0.77
AF347015.26	-0.71	-0.76
AF347015.15	-0.69	-0.73

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0004872	receptor activity	IEA		-
GO:0005515	protein binding	IPI		16431922
GO:0004987	kappa-opioid receptor activity	IEA		-
GO:0004987	kappa-opioid receptor activity	TAS		8755601
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007268	synaptic transmission	TAS	neuron, Synap, Neurotransmitter (GO term level: 6)	7624359
GO:0007186	G-protein coupled receptor protein signaling pathway	IEA		-
GO:0007193	G-protein signaling, adenylate cyclase inhibiting pathway	TAS		7624359
GO:0007165	signal transduction	IEA		-
GO:0007610	behavior	TAS		7624359
GO:0007600	sensory perception	TAS		7624359
GO:0006955	immune response	TAS		8755601
GO:0019079	viral genome replication	TAS		8755601
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0016021	integral to membrane	IEA		-
GO:0005886	plasma membrane	IEA		-
GO:0005887	integral to plasma membrane	TAS		7624359

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG NEUROACTIVE LIGAND RECEPTOR INTERACTION	272	195	All SZGR 2.0 genes in this pathway
BIOCARTA DREAM PATHWAY	14	13	All SZGR 2.0 genes in this pathway
REACTOME SIGNALING BY GPCR	920	449	All SZGR 2.0 genes in this pathway
REACTOME PEPTIDE LIGAND BINDING RECEPTORS	188	108	All SZGR 2.0 genes in this pathway
REACTOME CLASS A1 RHODOPSIN LIKE RECEPTORS	305	177	All SZGR 2.0 genes in this pathway
REACTOME GPCR DOWNSTREAM SIGNALING	805	368	All SZGR 2.0 genes in this pathway
REACTOME G ALPHA I SIGNALLING EVENTS	195	114	All SZGR 2.0 genes in this pathway
REACTOME GPCR LIGAND BINDING	408	246	All SZGR 2.0 genes in this pathway
ODONNELL METASTASIS UP	82	58	All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS	1038	678	All SZGR 2.0 genes in this pathway
KAUFFMANN DNA REPLICATION GENES	147	87	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 48HR DN	504	323	All SZGR 2.0 genes in this pathway
SATO SILENCED BY METHYLATION IN PANCREATIC CANCER 1	419	273	All SZGR 2.0 genes in this pathway
IWANAGA CARCINOGENESIS BY KRAS PTEN DN	353	226	All SZGR 2.0 genes in this pathway
LABBE TGFB1 TARGETS UP	102	64	All SZGR 2.0 genes in this pathway
LABBE TARGETS OF TGFB1 AND WNT3A UP	111	70	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP	1305	895	All SZGR 2.0 genes in this pathway
ROME INSULIN TARGETS IN MUSCLE DN	204	114	All SZGR 2.0 genes in this pathway
MIKKELSEN IPS LCP WITH H3K4ME3	174	100	All SZGR 2.0 genes in this pathway
MIKKELSEN ES LCP WITH H3K4ME3	142	80	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 30MIN DN	150	99	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-381	3517	3523	1A	hsa-miR-381	UAUACAAGGGCAAGCUCUCUGU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: OPRK1