Gene Page: ARHGEF4
Summary ?
| GeneID | 50649 |
| Symbol | ARHGEF4 |
| Synonyms | ASEF|ASEF1|GEF4|STM6 |
| Description | Rho guanine nucleotide exchange factor 4 |
| Reference | MIM:605216|HGNC:HGNC:684|Ensembl:ENSG00000136002|HPRD:05559|Vega:OTTHUMG00000131657 |
| Gene type | protein-coding |
| Map location | 2q22 |
| Pascal p-value | 0.002 |
| Sherlock p-value | 0.215 |
| Support | CompositeSet Darnell FMRP targets |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| GSMA_I | Genome scan meta-analysis | Psr: 0.023 | |
| GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.00755 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0005089 | Rho guanyl-nucleotide exchange factor activity | IEA | - | |
| GO:0005089 | Rho guanyl-nucleotide exchange factor activity | NAS | - | |
| GO:0005085 | guanyl-nucleotide exchange factor activity | IEA | - | |
| GO:0019904 | protein domain specific binding | IPI | 10947987 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007242 | intracellular signaling cascade | IEA | - | |
| GO:0007242 | intracellular signaling cascade | NAS | - | |
| GO:0035023 | regulation of Rho protein signal transduction | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005575 | cellular_component | ND | - | |
| GO:0005622 | intracellular | IEA | - | |
| GO:0005737 | cytoplasm | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG REGULATION OF ACTIN CYTOSKELETON | 216 | 144 | All SZGR 2.0 genes in this pathway |
| BIOCARTA MYOSIN PATHWAY | 31 | 22 | All SZGR 2.0 genes in this pathway |
| BIOCARTA PAR1 PATHWAY | 37 | 28 | All SZGR 2.0 genes in this pathway |
| PID MET PATHWAY | 80 | 60 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNALING BY RHO GTPASES | 113 | 81 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNALLING BY NGF | 217 | 167 | All SZGR 2.0 genes in this pathway |
| REACTOME NRAGE SIGNALS DEATH THROUGH JNK | 43 | 33 | All SZGR 2.0 genes in this pathway |
| REACTOME CELL DEATH SIGNALLING VIA NRAGE NRIF AND NADE | 60 | 43 | All SZGR 2.0 genes in this pathway |
| REACTOME P75 NTR RECEPTOR MEDIATED SIGNALLING | 81 | 61 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNALING BY GPCR | 920 | 449 | All SZGR 2.0 genes in this pathway |
| REACTOME G ALPHA1213 SIGNALLING EVENTS | 74 | 56 | All SZGR 2.0 genes in this pathway |
| REACTOME GPCR DOWNSTREAM SIGNALING | 805 | 368 | All SZGR 2.0 genes in this pathway |
| DAVICIONI MOLECULAR ARMS VS ERMS UP | 332 | 228 | All SZGR 2.0 genes in this pathway |
| JAEGER METASTASIS DN | 258 | 141 | All SZGR 2.0 genes in this pathway |
| ENK UV RESPONSE KERATINOCYTE DN | 485 | 334 | All SZGR 2.0 genes in this pathway |
| PEREZ TP53 TARGETS | 1174 | 695 | All SZGR 2.0 genes in this pathway |
| MOHANKUMAR TLX1 TARGETS DN | 193 | 112 | All SZGR 2.0 genes in this pathway |
| DAIRKEE TERT TARGETS UP | 380 | 213 | All SZGR 2.0 genes in this pathway |
| YANG BREAST CANCER ESR1 LASER DN | 50 | 38 | All SZGR 2.0 genes in this pathway |
| ONDER CDH1 TARGETS 2 DN | 464 | 276 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE INCIPIENT DN | 165 | 106 | All SZGR 2.0 genes in this pathway |
| SATO SILENCED BY METHYLATION IN PANCREATIC CANCER 1 | 419 | 273 | All SZGR 2.0 genes in this pathway |
| CREIGHTON ENDOCRINE THERAPY RESISTANCE 2 | 473 | 224 | All SZGR 2.0 genes in this pathway |
| IWANAGA CARCINOGENESIS BY KRAS PTEN DN | 353 | 226 | All SZGR 2.0 genes in this pathway |
| MEISSNER NPC HCP WITH H3 UNMETHYLATED | 536 | 296 | All SZGR 2.0 genes in this pathway |
| BROWNE HCMV INFECTION 4HR DN | 254 | 158 | All SZGR 2.0 genes in this pathway |
| ACEVEDO FGFR1 TARGETS IN PROSTATE CANCER MODEL UP | 289 | 184 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-124.1 | 805 | 811 | m8 | hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA |
| miR-124/506 | 805 | 811 | 1A | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
| hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
| miR-135 | 828 | 835 | 1A,m8 | hsa-miR-135a | UAUGGCUUUUUAUUCCUAUGUGA |
| hsa-miR-135b | UAUGGCUUUUCAUUCCUAUGUG | ||||
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.