Gene Page: LUC7L2
Summary ?
GeneID | 51631 |
Symbol | LUC7L2 |
Synonyms | CGI-59|CGI-74|LUC7B2 |
Description | LUC7-like 2 pre-mRNA splicing factor |
Reference | MIM:613056|HGNC:HGNC:21608|Ensembl:ENSG00000146963|HPRD:17456|Vega:OTTHUMG00000185163 |
Gene type | protein-coding |
Map location | 7q34 |
Pascal p-value | 0.031 |
Sherlock p-value | 0.966 |
eGene | Myers' cis & trans |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.0179 |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs6467822 | chr7 | 138773010 | LUC7L2 | 51631 | 0.13 | cis | ||
rs1507047 | chr16 | 50932778 | LUC7L2 | 51631 | 0.09 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005515 | protein binding | IPI | 17353931 | |
GO:0008270 | zinc ion binding | IEA | - | |
GO:0046872 | metal ion binding | IEA | - |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
ALB | DKFZp779N1935 | PRO0883 | PRO0903 | PRO1341 | albumin | Two-hybrid | BioGRID | 16169070 |
ATRX | ATR2 | MGC2094 | MRXHF1 | RAD54 | RAD54L | SFM1 | SHS | XH2 | XNP | ZNF-HX | alpha thalassemia/mental retardation syndrome X-linked (RAD54 homolog, S. cerevisiae) | Two-hybrid | BioGRID | 16169070 |
C14orf139 | FLJ21276 | chromosome 14 open reading frame 139 | Two-hybrid | BioGRID | 16169070 |
CCDC53 | CGI-116 | coiled-coil domain containing 53 | Two-hybrid | BioGRID | 16169070 |
CDK5RAP2 | C48 | Cep215 | DKFZp686B1070 | DKFZp686D1070 | KIAA1633 | MCPH3 | CDK5 regulatory subunit associated protein 2 | Two-hybrid | BioGRID | 16169070 |
CHD3 | Mi-2a | Mi2-ALPHA | ZFH | chromodomain helicase DNA binding protein 3 | Two-hybrid | BioGRID | 16169070 |
FAM173A | C16orf24 | MGC2494 | family with sequence similarity 173, member A | Two-hybrid | BioGRID | 16169070 |
FXR1 | - | fragile X mental retardation, autosomal homolog 1 | Two-hybrid | BioGRID | 16169070 |
GADD45G | CR6 | DDIT2 | GADD45gamma | GRP17 | growth arrest and DNA-damage-inducible, gamma | - | HPRD | 15383276 |
KIAA1377 | - | KIAA1377 | Two-hybrid | BioGRID | 16169070 |
KLHL20 | KHLHX | KLEIP | KLHLX | RP3-383J4.3 | kelch-like 20 (Drosophila) | Two-hybrid | BioGRID | 16169070 |
LPL | HDLCQ11 | LIPD | lipoprotein lipase | Two-hybrid | BioGRID | 16169070 |
LUC7L2 | CGI-59 | CGI-74 | FLJ10657 | LUC7B2 | LUC7-like 2 (S. cerevisiae) | Two-hybrid | BioGRID | 16169070 |
MAN2A2 | MANA2X | mannosidase, alpha, class 2A, member 2 | Two-hybrid | BioGRID | 16169070 |
MAP1LC3B | LC3B | MAP1A/1BLC3 | microtubule-associated protein 1 light chain 3 beta | Two-hybrid | BioGRID | 16169070 |
NAP1L5 | DRLM | nucleosome assembly protein 1-like 5 | Two-hybrid | BioGRID | 16169070 |
NASP | DKFZp547F162 | FLB7527 | FLJ31599 | FLJ35510 | MGC19722 | MGC20372 | MGC2297 | PRO1999 | nuclear autoantigenic sperm protein (histone-binding) | Two-hybrid | BioGRID | 16169070 |
NAT9 | DKFZp564C103 | EBSP | N-acetyltransferase 9 (GCN5-related, putative) | Two-hybrid | BioGRID | 16169070 |
NDUFA4L2 | FLJ26118 | NUOMS | NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4-like 2 | Two-hybrid | BioGRID | 16169070 |
NKAP | FLJ22626 | NFKB activating protein | Two-hybrid | BioGRID | 16169070 |
NSF | SKD2 | N-ethylmaleimide-sensitive factor | Two-hybrid | BioGRID | 16169070 |
NUTF2 | NTF2 | PP15 | nuclear transport factor 2 | Two-hybrid | BioGRID | 16169070 |
OFD1 | 71-7A | CXorf5 | MGC117039 | MGC117040 | SGBS2 | oral-facial-digital syndrome 1 | Two-hybrid | BioGRID | 16169070 |
PEA15 | HMAT1 | HUMMAT1H | MAT1 | MAT1H | PEA-15 | PED | phosphoprotein enriched in astrocytes 15 | Two-hybrid | BioGRID | 16169070 |
PTCD3 | DKFZp666K071 | FLJ20758 | Pentatricopeptide repeat domain 3 | Two-hybrid | BioGRID | 16169070 |
PTN | HARP | HBGF8 | HBNF | NEGF1 | pleiotrophin | Two-hybrid | BioGRID | 16169070 |
RNPS1 | E5.1 | MGC117332 | RNA binding protein S1, serine-rich domain | Affinity Capture-MS | BioGRID | 17353931 |
SAT1 | DC21 | KFSD | SAT | SSAT | SSAT-1 | spermidine/spermine N1-acetyltransferase 1 | Two-hybrid | BioGRID | 16169070 |
SSFA2 | CS-1 | CS1 | DKFZp313O1039 | DKFZp779G0129 | FLJ45996 | KIAA1927 | KRAP | SPAG13 | sperm specific antigen 2 | Two-hybrid | BioGRID | 16169070 |
SVIL | DKFZp686A17191 | supervillin | Two-hybrid | BioGRID | 16169070 |
ULK2 | KIAA0623 | Unc51.2 | unc-51-like kinase 2 (C. elegans) | Two-hybrid | BioGRID | 16169070 |
UNC119 | HRG4 | unc-119 homolog (C. elegans) | Two-hybrid | BioGRID | 16169070 |
YWHAG | 14-3-3GAMMA | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide | Affinity Capture-MS | BioGRID | 17353931 |
YWHAG | 14-3-3GAMMA | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide | - | HPRD | 15324660 |
YWHAQ | 14-3-3 | 1C5 | HS1 | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide | Affinity Capture-MS | BioGRID | 17353931 |
ZCCHC10 | FLJ20094 | zinc finger, CCHC domain containing 10 | Two-hybrid | BioGRID | 16169070 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
ONKEN UVEAL MELANOMA UP | 783 | 507 | All SZGR 2.0 genes in this pathway |
CASORELLI ACUTE PROMYELOCYTIC LEUKEMIA DN | 663 | 425 | All SZGR 2.0 genes in this pathway |
DODD NASOPHARYNGEAL CARCINOMA DN | 1375 | 806 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN DN | 770 | 415 | All SZGR 2.0 genes in this pathway |
MARTORIATI MDM4 TARGETS FETAL LIVER UP | 227 | 137 | All SZGR 2.0 genes in this pathway |
GUO HEX TARGETS UP | 81 | 54 | All SZGR 2.0 genes in this pathway |
CUI TCF21 TARGETS 2 DN | 830 | 547 | All SZGR 2.0 genes in this pathway |
MARIADASON REGULATED BY HISTONE ACETYLATION DN | 54 | 30 | All SZGR 2.0 genes in this pathway |
BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
BOYLAN MULTIPLE MYELOMA C D UP | 139 | 95 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS UP | 504 | 321 | All SZGR 2.0 genes in this pathway |
JOHNSTONE PARVB TARGETS 2 DN | 336 | 211 | All SZGR 2.0 genes in this pathway |
JOHNSTONE PARVB TARGETS 3 DN | 918 | 550 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE VIA TP53 GROUP D | 280 | 158 | All SZGR 2.0 genes in this pathway |
CHANGOLKAR H2AFY TARGETS DN | 40 | 26 | All SZGR 2.0 genes in this pathway |
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-124/506 | 904 | 911 | 1A,m8 | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
miR-320 | 350 | 356 | m8 | hsa-miR-320 | AAAAGCUGGGUUGAGAGGGCGAA |
miR-9 | 923 | 929 | m8 | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
miR-93.hd/291-3p/294/295/302/372/373/520 | 724 | 730 | m8 | hsa-miR-93brain | AAAGUGCUGUUCGUGCAGGUAG |
hsa-miR-302a | UAAGUGCUUCCAUGUUUUGGUGA | ||||
hsa-miR-302b | UAAGUGCUUCCAUGUUUUAGUAG | ||||
hsa-miR-302c | UAAGUGCUUCCAUGUUUCAGUGG | ||||
hsa-miR-302d | UAAGUGCUUCCAUGUUUGAGUGU | ||||
hsa-miR-372 | AAAGUGCUGCGACAUUUGAGCGU | ||||
hsa-miR-373 | GAAGUGCUUCGAUUUUGGGGUGU | ||||
hsa-miR-520e | AAAGUGCUUCCUUUUUGAGGG | ||||
hsa-miR-520a | AAAGUGCUUCCCUUUGGACUGU | ||||
hsa-miR-520b | AAAGUGCUUCCUUUUAGAGGG | ||||
hsa-miR-520c | AAAGUGCUUCCUUUUAGAGGGUU | ||||
hsa-miR-520d | AAAGUGCUUCUCUUUGGUGGGUU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.