Gene Page: SHC3
Summary ?
| GeneID | 53358 |
| Symbol | SHC3 |
| Synonyms | N-Shc|NSHC|RAI|SHCC |
| Description | SHC (Src homology 2 domain containing) transforming protein 3 |
| Reference | MIM:605263|HGNC:HGNC:18181|Ensembl:ENSG00000148082|HPRD:12005|Vega:OTTHUMG00000020179 |
| Gene type | protein-coding |
| Map location | 9q22.1 |
| Pascal p-value | 0.173 |
| Sherlock p-value | 0.002 |
| Fetal beta | -0.225 |
| eGene | Myers' cis & trans Meta |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 2 |
Section I. Genetics and epigenetics annotation
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs7858626 | chr9 | 91612638 | SHC3 | 53358 | 0.07 | cis | ||
| rs3750396 | chr9 | 91622176 | SHC3 | 53358 | 0.02 | cis | ||
| rs3812501 | chr9 | 91624396 | SHC3 | 53358 | 0.03 | cis | ||
| rs9410299 | chr9 | 91639787 | SHC3 | 53358 | 0.02 | cis | ||
| rs6733654 | chr2 | 1963270 | SHC3 | 53358 | 0.05 | trans | ||
| rs17495716 | chr2 | 160386522 | SHC3 | 53358 | 0.12 | trans | ||
| rs11953760 | chr5 | 9842943 | SHC3 | 53358 | 0.2 | trans | ||
| rs135346 | chr22 | 48409540 | SHC3 | 53358 | 0.13 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0004871 | signal transducer activity | TAS | 8808684 | |
| GO:0005515 | protein binding | IEA | - | |
| GO:0005515 | protein binding | IPI | 11877420 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0007417 | central nervous system development | TAS | Brain (GO term level: 6) | 8808684 |
| GO:0035249 | synaptic transmission, glutamatergic | IEA | neuron, glutamate, Synap, Neurotransmitter (GO term level: 8) | - |
| GO:0007173 | epidermal growth factor receptor signaling pathway | TAS | 8808684 | |
| GO:0007265 | Ras protein signal transduction | EXP | 11520933 | |
| GO:0007242 | intracellular signaling cascade | NAS | - | |
| GO:0007611 | learning or memory | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005575 | cellular_component | ND | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG ERBB SIGNALING PATHWAY | 87 | 71 | All SZGR 2.0 genes in this pathway |
| KEGG CHEMOKINE SIGNALING PATHWAY | 190 | 128 | All SZGR 2.0 genes in this pathway |
| KEGG FOCAL ADHESION | 201 | 138 | All SZGR 2.0 genes in this pathway |
| KEGG NATURAL KILLER CELL MEDIATED CYTOTOXICITY | 137 | 92 | All SZGR 2.0 genes in this pathway |
| KEGG NEUROTROPHIN SIGNALING PATHWAY | 126 | 103 | All SZGR 2.0 genes in this pathway |
| KEGG INSULIN SIGNALING PATHWAY | 137 | 103 | All SZGR 2.0 genes in this pathway |
| KEGG GLIOMA | 65 | 56 | All SZGR 2.0 genes in this pathway |
| KEGG CHRONIC MYELOID LEUKEMIA | 73 | 59 | All SZGR 2.0 genes in this pathway |
| PID TRKR PATHWAY | 62 | 48 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNALLING BY NGF | 217 | 167 | All SZGR 2.0 genes in this pathway |
| REACTOME INSULIN RECEPTOR SIGNALLING CASCADE | 87 | 64 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNALLING TO RAS | 27 | 23 | All SZGR 2.0 genes in this pathway |
| REACTOME NGF SIGNALLING VIA TRKA FROM THE PLASMA MEMBRANE | 137 | 105 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNALLING TO ERKS | 36 | 30 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNALING BY INSULIN RECEPTOR | 108 | 72 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNAL ATTENUATION | 14 | 8 | All SZGR 2.0 genes in this pathway |
| REACTOME SHC MEDIATED SIGNALLING | 15 | 12 | All SZGR 2.0 genes in this pathway |
| REACTOME SHC RELATED EVENTS | 17 | 13 | All SZGR 2.0 genes in this pathway |
| ZHOU INFLAMMATORY RESPONSE FIMA DN | 284 | 156 | All SZGR 2.0 genes in this pathway |
| KOKKINAKIS METHIONINE DEPRIVATION 48HR UP | 128 | 95 | All SZGR 2.0 genes in this pathway |
| KOKKINAKIS METHIONINE DEPRIVATION 96HR UP | 117 | 84 | All SZGR 2.0 genes in this pathway |
| GRUETZMANN PANCREATIC CANCER DN | 203 | 134 | All SZGR 2.0 genes in this pathway |
| KIM MYC AMPLIFICATION TARGETS UP | 201 | 127 | All SZGR 2.0 genes in this pathway |
| KIM MYCN AMPLIFICATION TARGETS UP | 92 | 64 | All SZGR 2.0 genes in this pathway |
| NUYTTEN EZH2 TARGETS UP | 1037 | 673 | All SZGR 2.0 genes in this pathway |
| GUENTHER GROWTH SPHERICAL VS ADHERENT UP | 21 | 15 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE DN | 1237 | 837 | All SZGR 2.0 genes in this pathway |
| WESTON VEGFA TARGETS 6HR | 59 | 38 | All SZGR 2.0 genes in this pathway |
| CUI TCF21 TARGETS 2 DN | 830 | 547 | All SZGR 2.0 genes in this pathway |
| WESTON VEGFA TARGETS | 108 | 71 | All SZGR 2.0 genes in this pathway |
| WESTON VEGFA TARGETS 3HR | 74 | 47 | All SZGR 2.0 genes in this pathway |
| YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
| YAGI AML WITH 11Q23 REARRANGED | 351 | 238 | All SZGR 2.0 genes in this pathway |
| KYNG NORMAL AGING UP | 19 | 11 | All SZGR 2.0 genes in this pathway |
| KYNG WERNER SYNDROM DN | 29 | 14 | All SZGR 2.0 genes in this pathway |
| KIM ALL DISORDERS DURATION CORR UP | 9 | 7 | All SZGR 2.0 genes in this pathway |
| JOHNSTONE PARVB TARGETS 1 DN | 63 | 39 | All SZGR 2.0 genes in this pathway |
| BRUINS UVC RESPONSE VIA TP53 GROUP B | 549 | 316 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-378 | 35 | 41 | m8 | hsa-miR-378 | CUCCUGACUCCAGGUCCUGUGU |
| miR-493-5p | 209 | 215 | 1A | hsa-miR-493-5p | UUGUACAUGGUAGGCUUUCAUU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.