Gene Page: PLP1
Summary ?
GeneID | 5354 |
Symbol | PLP1 |
Synonyms | GPM6C|HLD1|MMPL|PLP|PLP/DM20|PMD|SPG2 |
Description | proteolipid protein 1 |
Reference | MIM:300401|HGNC:HGNC:9086|Ensembl:ENSG00000123560|HPRD:02321|Vega:OTTHUMG00000022111 |
Gene type | protein-coding |
Map location | Xq22 |
Sherlock p-value | 0.126 |
Fetal beta | -3.785 |
Support | CELL ADHESION AND TRANSSYNAPTIC SIGNALING G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-CONSENSUS G2Cdb.human_BAYES-COLLINS-HUMAN-PSD-FULL G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS G2Cdb.human_TAP-PSD-95-CORE G2Cdb.humanARC G2Cdb.humanNRC CompositeSet Darnell FMRP targets |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Association | A combined odds ratio method (Sun et al. 2008), association studies | 1 | Link to SZGene |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 4 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0005515 | protein binding | IEA | - | |
GO:0005198 | structural molecule activity | TAS | 2479017 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0022010 | myelination in the central nervous system | IEA | neuron, axon, oligodendrocyte, dendrite (GO term level: 14) | - |
GO:0008366 | axon ensheathment | TAS | neuron, axon (GO term level: 12) | 2479017 |
GO:0007268 | synaptic transmission | TAS | neuron, Synap, Neurotransmitter (GO term level: 6) | 2479017 |
GO:0048469 | cell maturation | IEA | - | |
GO:0042759 | long-chain fatty acid biosynthetic process | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0043209 | myelin sheath | IEA | neuron, axon, oligodendrocyte, Glial (GO term level: 7) | - |
GO:0016020 | membrane | IEA | - | |
GO:0016021 | integral to membrane | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
SENGUPTA NASOPHARYNGEAL CARCINOMA WITH LMP1 DN | 175 | 82 | All SZGR 2.0 genes in this pathway |
VECCHI GASTRIC CANCER EARLY DN | 367 | 220 | All SZGR 2.0 genes in this pathway |
SABATES COLORECTAL ADENOMA DN | 291 | 176 | All SZGR 2.0 genes in this pathway |
VANHARANTA UTERINE FIBROID UP | 45 | 26 | All SZGR 2.0 genes in this pathway |
MCBRYAN PUBERTAL BREAST 3 4WK DN | 39 | 27 | All SZGR 2.0 genes in this pathway |
RASHI RESPONSE TO IONIZING RADIATION 5 | 147 | 89 | All SZGR 2.0 genes in this pathway |
JOHANSSON BRAIN CANCER EARLY VS LATE DN | 45 | 35 | All SZGR 2.0 genes in this pathway |
JAZAG TGFB1 SIGNALING UP | 108 | 69 | All SZGR 2.0 genes in this pathway |
BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
ASTON MAJOR DEPRESSIVE DISORDER DN | 160 | 110 | All SZGR 2.0 genes in this pathway |
SHEPARD BMYB MORPHOLINO DN | 200 | 112 | All SZGR 2.0 genes in this pathway |
SHEPARD BMYB TARGETS | 74 | 41 | All SZGR 2.0 genes in this pathway |
SHEPARD CRUSH AND BURN MUTANT DN | 185 | 111 | All SZGR 2.0 genes in this pathway |
CHESLER BRAIN HIGHEST EXPRESSION | 40 | 29 | All SZGR 2.0 genes in this pathway |
KAAB FAILED HEART ATRIUM DN | 141 | 99 | All SZGR 2.0 genes in this pathway |
KAAB HEART ATRIUM VS VENTRICLE UP | 249 | 170 | All SZGR 2.0 genes in this pathway |
RAMASWAMY METASTASIS DN | 61 | 47 | All SZGR 2.0 genes in this pathway |
BROWNE HCMV INFECTION 48HR DN | 504 | 323 | All SZGR 2.0 genes in this pathway |
LU AGING BRAIN UP | 262 | 186 | All SZGR 2.0 genes in this pathway |
NIELSEN SCHWANNOMA UP | 18 | 16 | All SZGR 2.0 genes in this pathway |
WANG SMARCE1 TARGETS UP | 280 | 183 | All SZGR 2.0 genes in this pathway |
LEIN MIDBRAIN MARKERS | 82 | 55 | All SZGR 2.0 genes in this pathway |
BOQUEST STEM CELL UP | 260 | 174 | All SZGR 2.0 genes in this pathway |
LABBE TARGETS OF TGFB1 AND WNT3A DN | 108 | 68 | All SZGR 2.0 genes in this pathway |
WEST ADRENOCORTICAL TUMOR DN | 546 | 362 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS DN | 366 | 257 | All SZGR 2.0 genes in this pathway |
TAVAZOIE METASTASIS | 108 | 68 | All SZGR 2.0 genes in this pathway |
KIM ALL DISORDERS OLIGODENDROCYTE NUMBER CORR UP | 756 | 494 | All SZGR 2.0 genes in this pathway |
KIM PTEN TARGETS UP | 18 | 9 | All SZGR 2.0 genes in this pathway |
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN | 1080 | 713 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-140 | 41 | 47 | 1A | hsa-miR-140brain | AGUGGUUUUACCCUAUGGUAG |
miR-146 | 2010 | 2016 | 1A | hsa-miR-146a | UGAGAACUGAAUUCCAUGGGUU |
hsa-miR-146bbrain | UGAGAACUGAAUUCCAUAGGCU | ||||
miR-186 | 1130 | 1136 | m8 | hsa-miR-186 | CAAAGAAUUCUCCUUUUGGGCUU |
miR-26 | 111 | 117 | m8 | hsa-miR-26abrain | UUCAAGUAAUCCAGGAUAGGC |
hsa-miR-26bSZ | UUCAAGUAAUUCAGGAUAGGUU | ||||
miR-29 | 986 | 992 | m8 | hsa-miR-29aSZ | UAGCACCAUCUGAAAUCGGUU |
hsa-miR-29bSZ | UAGCACCAUUUGAAAUCAGUGUU | ||||
hsa-miR-29cSZ | UAGCACCAUUUGAAAUCGGU | ||||
miR-361 | 1908 | 1914 | m8 | hsa-miR-361brain | UUAUCAGAAUCUCCAGGGGUAC |
miR-362 | 572 | 578 | m8 | hsa-miR-362 | AAUCCUUGGAACCUAGGUGUGAGU |
hsa-miR-362 | AAUCCUUGGAACCUAGGUGUGAGU | ||||
miR-543 | 2006 | 2012 | m8 | hsa-miR-543 | AAACAUUCGCGGUGCACUUCU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.