Gene Page: SLC44A2
Summary ?
GeneID | 57153 |
Symbol | SLC44A2 |
Synonyms | CTL2|PP1292 |
Description | solute carrier family 44 member 2 |
Reference | MIM:606106|HGNC:HGNC:17292|Ensembl:ENSG00000129353|HPRD:16198|Vega:OTTHUMG00000180585 |
Gene type | protein-coding |
Map location | 19p13.1 |
Pascal p-value | 0.63 |
Sherlock p-value | 0.506 |
Fetal beta | -0.094 |
DMG | 2 (# studies) |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 2 |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 2 |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 2 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg21631439 | 19 | 10736448 | SLC44A2 | 3.631E-4 | -0.487 | 0.042 | DMG:Wockner_2014 |
cg01247891 | 19 | 10713543 | SLC44A2 | 4.37E-9 | -0.012 | 2.6E-6 | DMG:Jaffe_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0015220 | choline transmembrane transporter activity | TAS | Neurotransmitter (GO term level: 6) | 10677542 |
GO:0004871 | signal transducer activity | IMP | 12761501 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0015871 | choline transport | TAS | Neurotransmitter (GO term level: 6) | 10677542 |
GO:0006810 | transport | IEA | - | |
GO:0043123 | positive regulation of I-kappaB kinase/NF-kappaB cascade | IMP | 12761501 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005813 | centrosome | IDA | 18029348 | |
GO:0005856 | cytoskeleton | IDA | 18029348 | |
GO:0016020 | membrane | IEA | - | |
GO:0016021 | integral to membrane | TAS | 10677542 | |
GO:0043231 | intracellular membrane-bounded organelle | IDA | 18029348 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
REACTOME PHOSPHOLIPID METABOLISM | 198 | 112 | All SZGR 2.0 genes in this pathway |
REACTOME SYNTHESIS OF PC | 18 | 9 | All SZGR 2.0 genes in this pathway |
REACTOME GLYCEROPHOSPHOLIPID BIOSYNTHESIS | 82 | 39 | All SZGR 2.0 genes in this pathway |
REACTOME TRANSMEMBRANE TRANSPORT OF SMALL MOLECULES | 413 | 270 | All SZGR 2.0 genes in this pathway |
REACTOME SLC MEDIATED TRANSMEMBRANE TRANSPORT | 241 | 157 | All SZGR 2.0 genes in this pathway |
REACTOME TRANSPORT OF GLUCOSE AND OTHER SUGARS BILE SALTS AND ORGANIC ACIDS METAL IONS AND AMINE COMPOUNDS | 89 | 54 | All SZGR 2.0 genes in this pathway |
REACTOME AMINE COMPOUND SLC TRANSPORTERS | 27 | 16 | All SZGR 2.0 genes in this pathway |
REACTOME METABOLISM OF LIPIDS AND LIPOPROTEINS | 478 | 302 | All SZGR 2.0 genes in this pathway |
GARY CD5 TARGETS UP | 473 | 314 | All SZGR 2.0 genes in this pathway |
CHARAFE BREAST CANCER LUMINAL VS MESENCHYMAL UP | 450 | 256 | All SZGR 2.0 genes in this pathway |
LINDGREN BLADDER CANCER CLUSTER 1 DN | 378 | 231 | All SZGR 2.0 genes in this pathway |
GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
BERENJENO TRANSFORMED BY RHOA DN | 394 | 258 | All SZGR 2.0 genes in this pathway |
MCBRYAN PUBERTAL BREAST 4 5WK UP | 271 | 175 | All SZGR 2.0 genes in this pathway |
MCBRYAN PUBERTAL BREAST 5 6WK UP | 116 | 68 | All SZGR 2.0 genes in this pathway |
NUYTTEN EZH2 TARGETS UP | 1037 | 673 | All SZGR 2.0 genes in this pathway |
RICKMAN TUMOR DIFFERENTIATED MODERATELY VS POORLY UP | 121 | 71 | All SZGR 2.0 genes in this pathway |
BENPORATH CYCLING GENES | 648 | 385 | All SZGR 2.0 genes in this pathway |
SHEPARD CRUSH AND BURN MUTANT DN | 185 | 111 | All SZGR 2.0 genes in this pathway |
ZHENG RESPONSE TO ARSENITE DN | 18 | 15 | All SZGR 2.0 genes in this pathway |
BRACHAT RESPONSE TO CAMPTOTHECIN DN | 46 | 31 | All SZGR 2.0 genes in this pathway |
CREIGHTON ENDOCRINE THERAPY RESISTANCE 5 | 482 | 296 | All SZGR 2.0 genes in this pathway |
MASSARWEH TAMOXIFEN RESISTANCE UP | 578 | 341 | All SZGR 2.0 genes in this pathway |
ZHANG TLX TARGETS 36HR UP | 221 | 150 | All SZGR 2.0 genes in this pathway |
MILI PSEUDOPODIA CHEMOTAXIS DN | 457 | 302 | All SZGR 2.0 genes in this pathway |
MILI PSEUDOPODIA HAPTOTAXIS DN | 668 | 419 | All SZGR 2.0 genes in this pathway |
MIKKELSEN ES ICP WITH H3K4ME3 | 718 | 401 | All SZGR 2.0 genes in this pathway |
WHITFIELD CELL CYCLE G2 M | 216 | 124 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS UP | 504 | 321 | All SZGR 2.0 genes in this pathway |
PILON KLF1 TARGETS DN | 1972 | 1213 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-124/506 | 568 | 574 | m8 | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
miR-182 | 918 | 925 | 1A,m8 | hsa-miR-182 | UUUGGCAAUGGUAGAACUCACA |
miR-34/449 | 99 | 105 | m8 | hsa-miR-34abrain | UGGCAGUGUCUUAGCUGGUUGUU |
hsa-miR-34c | AGGCAGUGUAGUUAGCUGAUUGC | ||||
hsa-miR-449 | UGGCAGUGUAUUGUUAGCUGGU | ||||
hsa-miR-449b | AGGCAGUGUAUUGUUAGCUGGC | ||||
miR-96 | 919 | 925 | 1A | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.