Gene Page: PTH1R
Summary ?
| GeneID | 5745 |
| Symbol | PTH1R |
| Synonyms | PFE|PTHR|PTHR1 |
| Description | parathyroid hormone 1 receptor |
| Reference | MIM:168468|HGNC:HGNC:9608|Ensembl:ENSG00000160801|HPRD:01347|Vega:OTTHUMG00000133515 |
| Gene type | protein-coding |
| Map location | 3p22-p21.1 |
| Pascal p-value | 0.714 |
| Sherlock p-value | 0.085 |
| Fetal beta | -1.311 |
| DMG | 1 (# studies) |
| eGene | Myers' cis & trans |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 2 |
| Network | Shortest path distance of core genes in the Human protein-protein interaction network | Contribution to shortest path in PPI network: 0.009 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg01178538 | 3 | 46932994 | PTH1R | 1.46E-4 | 0.261 | 0.031 | DMG:Wockner_2014 |
| cg11733272 | 3 | 46940439 | PTH1R | 5.921E-4 | -0.45 | 0.05 | DMG:Wockner_2014 |
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs11582961 | chr1 | 184023058 | PTH1R | 5745 | 0.15 | trans | ||
| rs17801458 | chr2 | 142468471 | PTH1R | 5745 | 0.16 | trans | ||
| rs2422581 | chr20 | 1495234 | PTH1R | 5745 | 0.02 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| HCK | 0.81 | 0.72 |
| ITGB2 | 0.79 | 0.73 |
| CD14 | 0.79 | 0.70 |
| CSF3R | 0.78 | 0.70 |
| LILRB4 | 0.77 | 0.74 |
| SPI1 | 0.77 | 0.76 |
| CD68 | 0.76 | 0.62 |
| DOCK2 | 0.75 | 0.59 |
| SIGLEC10 | 0.75 | 0.61 |
| WDFY4 | 0.74 | 0.68 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| NEUROD6 | -0.26 | -0.18 |
| SCUBE1 | -0.26 | -0.16 |
| GPR22 | -0.26 | -0.21 |
| FAT4 | -0.26 | -0.11 |
| SATB2 | -0.25 | -0.12 |
| SRGAP1 | -0.25 | -0.12 |
| MYCN | -0.25 | -0.14 |
| BACH2 | -0.25 | -0.10 |
| NEUROD2 | -0.25 | -0.13 |
| DACT1 | -0.25 | -0.12 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0004872 | receptor activity | IEA | - | |
| GO:0004930 | G-protein coupled receptor activity | IEA | - | |
| GO:0004991 | parathyroid hormone receptor activity | IEA | - | |
| GO:0004991 | parathyroid hormone receptor activity | TAS | 9927325 | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0001501 | skeletal system development | TAS | 9745456 | |
| GO:0007187 | G-protein signaling, coupled to cyclic nucleotide second messenger | TAS | 9927325 | |
| GO:0007186 | G-protein coupled receptor protein signaling pathway | IEA | - | |
| GO:0007165 | signal transduction | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005634 | nucleus | TAS | 10709993 | |
| GO:0005737 | cytoplasm | TAS | 10709993 | |
| GO:0016021 | integral to membrane | IEA | - | |
| GO:0005886 | plasma membrane | IEA | - | |
| GO:0005887 | integral to plasma membrane | TAS | 9745456 |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| KEGG NEUROACTIVE LIGAND RECEPTOR INTERACTION | 272 | 195 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNALING BY GPCR | 920 | 449 | All SZGR 2.0 genes in this pathway |
| REACTOME CLASS B 2 SECRETIN FAMILY RECEPTORS | 88 | 58 | All SZGR 2.0 genes in this pathway |
| REACTOME GPCR DOWNSTREAM SIGNALING | 805 | 368 | All SZGR 2.0 genes in this pathway |
| REACTOME G ALPHA S SIGNALLING EVENTS | 121 | 82 | All SZGR 2.0 genes in this pathway |
| REACTOME GPCR LIGAND BINDING | 408 | 246 | All SZGR 2.0 genes in this pathway |
| DAVICIONI MOLECULAR ARMS VS ERMS DN | 182 | 111 | All SZGR 2.0 genes in this pathway |
| KINSEY TARGETS OF EWSR1 FLII FUSION DN | 329 | 219 | All SZGR 2.0 genes in this pathway |
| ENK UV RESPONSE KERATINOCYTE UP | 530 | 342 | All SZGR 2.0 genes in this pathway |
| GRUETZMANN PANCREATIC CANCER DN | 203 | 134 | All SZGR 2.0 genes in this pathway |
| SHETH LIVER CANCER VS TXNIP LOSS PAM4 | 261 | 153 | All SZGR 2.0 genes in this pathway |
| LOPEZ MBD TARGETS | 957 | 597 | All SZGR 2.0 genes in this pathway |
| ASTON MAJOR DEPRESSIVE DISORDER UP | 49 | 36 | All SZGR 2.0 genes in this pathway |
| FLECHNER BIOPSY KIDNEY TRANSPLANT REJECTED VS OK DN | 546 | 351 | All SZGR 2.0 genes in this pathway |
| FLECHNER BIOPSY KIDNEY TRANSPLANT OK VS DONOR UP | 555 | 346 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE INCIPIENT UP | 390 | 242 | All SZGR 2.0 genes in this pathway |
| KAAB HEART ATRIUM VS VENTRICLE UP | 249 | 170 | All SZGR 2.0 genes in this pathway |
| YAMAZAKI TCEB3 TARGETS UP | 175 | 116 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
| LEE AGING MUSCLE DN | 46 | 29 | All SZGR 2.0 genes in this pathway |
| BAELDE DIABETIC NEPHROPATHY DN | 434 | 302 | All SZGR 2.0 genes in this pathway |
| DURCHDEWALD SKIN CARCINOGENESIS UP | 88 | 47 | All SZGR 2.0 genes in this pathway |
| ACEVEDO LIVER CANCER DN | 540 | 340 | All SZGR 2.0 genes in this pathway |
| ACEVEDO LIVER TUMOR VS NORMAL ADJACENT TISSUE DN | 274 | 165 | All SZGR 2.0 genes in this pathway |
| WEST ADRENOCORTICAL TUMOR DN | 546 | 362 | All SZGR 2.0 genes in this pathway |
| BOYAULT LIVER CANCER SUBCLASS G23 DN | 10 | 7 | All SZGR 2.0 genes in this pathway |
| CAIRO HEPATOBLASTOMA DN | 267 | 160 | All SZGR 2.0 genes in this pathway |
| MIKKELSEN NPC HCP WITH H3K27ME3 | 341 | 243 | All SZGR 2.0 genes in this pathway |
| YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 14 | 143 | 86 | All SZGR 2.0 genes in this pathway |
| MARTENS TRETINOIN RESPONSE UP | 857 | 456 | All SZGR 2.0 genes in this pathway |
| BHAT ESR1 TARGETS NOT VIA AKT1 UP | 211 | 131 | All SZGR 2.0 genes in this pathway |
| BHAT ESR1 TARGETS VIA AKT1 UP | 281 | 183 | All SZGR 2.0 genes in this pathway |
| LEE BMP2 TARGETS UP | 745 | 475 | All SZGR 2.0 genes in this pathway |
| PLASARI TGFB1 SIGNALING VIA NFIC 1HR DN | 106 | 77 | All SZGR 2.0 genes in this pathway |
| DELACROIX RAR BOUND ES | 462 | 273 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-133 | 46 | 52 | 1A | hsa-miR-133a | UUGGUCCCCUUCAACCAGCUGU |
| hsa-miR-133b | UUGGUCCCCUUCAACCAGCUA | ||||
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.