SZGR2

Summary ?

GeneID	57537
Symbol	SORCS2
Synonyms	-
Description	sortilin related VPS10 domain containing receptor 2
Reference	MIM:606284\|HGNC:HGNC:16698\|Ensembl:ENSG00000184985\|HPRD:12099\|Vega:OTTHUMG00000159981
Gene type	protein-coding
Map location	4p16.1
Pascal p-value	0.1
Sherlock p-value	0.201
DEG p-value	DEG:Zhao_2015:p=3.35e-04:q=0.0924
Fetal beta	-0.445
eGene	Hippocampus Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:GWASdb	Genome-wide Association Studies	GWASdb records for schizophrenia
CV:PGCnp	Genome-wide Association Study	GWAS
DEG:Zhao_2015	RNA Sequencing analysis	Transcriptome sequencing and genome-wide association analyses reveal lysosomal function and actin cytoskeleton remodeling in schizophrenia and bipolar disorder.
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	1
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 2

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg13927832	4	7436861	PSAPL1;SORCS2	5.718E-4	0.364	0.049	DMG:Wockner_2014

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	qvalue	eQTL type
rs6577553	chr1	9197460	SORCS2	57537	0.16	trans
rs17010881	chr2	124878125	SORCS2	57537	0.1	trans
rs9289452	chr3	133429642	SORCS2	57537	0.17	trans
rs6879593	chr5	75253310	SORCS2	57537	0.14	trans
rs16927065	chr10	26816050	SORCS2	57537	0.06	trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
ZNF777	0.95	0.96
ZNF574	0.94	0.96
ZNF598	0.94	0.95
CNOT3	0.94	0.95
ATP13A1	0.94	0.95
MEN1	0.93	0.95
ZNF446	0.93	0.93
TUBGCP2	0.93	0.94
TSC2	0.93	0.96
DVL3	0.93	0.95

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AF347015.31	-0.78	-0.86
MT-CO2	-0.76	-0.86
AF347015.27	-0.76	-0.84
AF347015.33	-0.74	-0.81
MT-CYB	-0.73	-0.82
C5orf53	-0.73	-0.74
AF347015.8	-0.72	-0.84
AF347015.21	-0.71	-0.89
S100B	-0.70	-0.77
COPZ2	-0.69	-0.74

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0008188	neuropeptide receptor activity	NAS	Neurotransmitter (GO term level: 8)	11499680
GO:0005515	protein binding	NAS		11499680
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007218	neuropeptide signaling pathway	NAS	Neurotransmitter (GO term level: 8)	11499680
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0016020	membrane	NAS		11499680
GO:0016021	integral to membrane	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
GOZGIT ESR1 TARGETS UP	149	84	All SZGR 2.0 genes in this pathway
GAUSSMANN MLL AF4 FUSION TARGETS E UP	97	60	All SZGR 2.0 genes in this pathway
SHETH LIVER CANCER VS TXNIP LOSS PAM5	94	59	All SZGR 2.0 genes in this pathway
NUYTTEN EZH2 TARGETS UP	1037	673	All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS	1062	725	All SZGR 2.0 genes in this pathway
GAVIN FOXP3 TARGETS CLUSTER P3	160	103	All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS 36HR UP	221	150	All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS 60HR UP	293	203	All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS UP	108	78	All SZGR 2.0 genes in this pathway
MEISSNER BRAIN HCP WITH H3K4ME3 AND H3K27ME3	1069	729	All SZGR 2.0 genes in this pathway
WONG ADULT TISSUE STEM MODULE	721	492	All SZGR 2.0 genes in this pathway
PANGAS TUMOR SUPPRESSION BY SMAD1 AND SMAD5 UP	134	85	All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE LATE	1137	655	All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS UP	745	475	All SZGR 2.0 genes in this pathway
VANOEVELEN MYOGENESIS SIN3A TARGETS	220	133	All SZGR 2.0 genes in this pathway
DURAND STROMA S UP	297	194	All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY	1839	928	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-124.1	2567	2573	m8	hsa-miR-124a	UUAAGGCACGCGGUGAAUGCCA
miR-124/506	2567	2573	1A	hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
miR-124/506	2567	2573	1A	hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC
miR-125/351	1148	1154	1A	hsa-miR-125b^brain	UCCCUGAGACCCUAACUUGUGA
miR-125/351	1148	1154	1A	hsa-miR-125a^brain	UCCCUGAGACCCUUUAACCUGUG

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: SORCS2