SZGR2

Summary ?

GeneID	578
Symbol	BAK1
Synonyms	BAK\|BAK-LIKE\|BCL2L7\|CDN1
Description	BCL2 antagonist/killer 1
Reference	MIM:600516\|HGNC:HGNC:949\|Ensembl:ENSG00000030110\|HPRD:02744\|Vega:OTTHUMG00000014530
Gene type	protein-coding
Map location	6p21.3
Pascal p-value	1.537E-4
Sherlock p-value	0.88
eGene	Cerebellar Hemisphere Cortex Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
Association	A combined odds ratio method (Sun et al. 2008), association studies	1	Link to SZGene
GSMA_I	Genome scan meta-analysis	Psr: 0.033

Section I. Genetics and epigenetics annotation

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs4522608	chr2	122574850	BAK1	578		0.12		trans
rs16829545	chr2	151977407	BAK1	578		0.02		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
ZNF428	0.93	0.93
RALY	0.91	0.91
NFKBIL1	0.91	0.89
CCDC94	0.91	0.92
SIRT6	0.90	0.92
AC011498.3	0.90	0.91
U2AF1	0.90	0.91
DNAJC17	0.90	0.92
NAGK	0.89	0.92
PRPF31	0.89	0.91

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AF347015.27	-0.72	-0.85
AF347015.31	-0.71	-0.83
AF347015.33	-0.71	-0.83
MT-CO2	-0.70	-0.82
MT-CYB	-0.70	-0.83
HLA-F	-0.68	-0.71
AF347015.8	-0.67	-0.82
AF347015.15	-0.67	-0.83
C5orf53	-0.66	-0.70
AF347015.2	-0.65	-0.83

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0042802	identical protein binding	IPI		15901672
GO:0046982	protein heterodimerization activity	IPI		10837489
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0001836	release of cytochrome c from mitochondria	IDA		9843949
GO:0006917	induction of apoptosis	TAS		10381623
GO:0008635	caspase activation via cytochrome c	IEA		-
GO:0010046	response to mycotoxin	IEA		-
GO:0009620	response to fungus	IEA		-
GO:0010248	establishment or maintenance of transmembrane electrochemical gradient	IDA		9843949
GO:0008053	mitochondrial fusion	IEA		-
GO:0042981	regulation of apoptosis	IEA		-
GO:0043496	regulation of protein homodimerization activity	IDA		9111042
GO:0043497	regulation of protein heterodimerization activity	IDA		9111042
GO:0046902	regulation of mitochondrial membrane permeability	IDA		9843949
GO:0051881	regulation of mitochondrial membrane potential	IDA		9843949
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005739	mitochondrion	IDA		9843949
GO:0005741	mitochondrial outer membrane	EXP		10950869 \|12721291
GO:0016020	membrane	IEA		-
GO:0046930	pore complex	IDA		9843949

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ACTR2	ARP2	ARP2 actin-related protein 2 homolog (yeast)	Affinity Capture-MS	BioGRID	17353931
AKAP13	AKAP-Lbc \| BRX \| FLJ11952 \| FLJ43341 \| HA-3 \| Ht31 \| LBC \| PROTO-LB \| PROTO-LBC \| c-lbc	A kinase (PRKA) anchor protein 13	Affinity Capture-MS	BioGRID	17353931
BAK1	BAK \| BAK-LIKE \| BCL2L7 \| CDN1 \| MGC117255 \| MGC3887	BCL2-antagonist/killer 1	Affinity Capture-Western	BioGRID	15077116
BAK1	BAK \| BAK-LIKE \| BCL2L7 \| CDN1 \| MGC117255 \| MGC3887	BCL2-antagonist/killer 1	BAK1 (Bak) interacts with itself to form a dimer.	BIND	15846303
BAX	BCL2L4	BCL2-associated X protein	-	HPRD,BioGRID	11571294
BCL2	Bcl-2	B-cell CLL/lymphoma 2	-	HPRD,BioGRID	11728179
BCL2A1	ACC-1 \| ACC-2 \| BCL2L5 \| BFL1 \| GRS \| HBPA1	BCL2-related protein A1	-	HPRD	10381646
BCL2L1	BCL-XL/S \| BCL2L \| BCLX \| Bcl-X \| DKFZp781P2092 \| bcl-xL \| bcl-xS	BCL2-like 1	-	HPRD,BioGRID	11175750
BCL2L2	BCL-W \| BCLW \| KIAA0271	BCL2-like 2	Affinity Capture-Western	BioGRID	10381646
BID	FP497 \| MGC15319 \| MGC42355	BH3 interacting domain death agonist	-	HPRD	10950869
DFFA	DFF-45 \| DFF1 \| ICAD	DNA fragmentation factor, 45kDa, alpha polypeptide	Affinity Capture-MS	BioGRID	17353931
FBL	FIB \| FLRN \| RNU3IP1	fibrillarin	Affinity Capture-MS	BioGRID	17353931
FRYL	DKFZp686E205 \| FLJ16177 \| KIAA0826	FRY-like	Affinity Capture-MS	BioGRID	17353931
HSPD1	CPN60 \| GROEL \| HSP60 \| HSP65 \| HuCHA60 \| SPG13	heat shock 60kDa protein 1 (chaperonin)	-	HPRD,BioGRID	12070120
KRT31	HA1 \| Ha-1 \| KRTHA1 \| MGC138630 \| hHa1	keratin 31	Affinity Capture-MS	BioGRID	17353931
MCL1	BCL2L3 \| EAT \| MCL1L \| MCL1S \| MGC104264 \| MGC1839 \| TM	myeloid cell leukemia sequence 1 (BCL2-related)	-	HPRD	10579309 \|10837489
MCL1	BCL2L3 \| EAT \| MCL1L \| MCL1S \| MGC104264 \| MGC1839 \| TM	myeloid cell leukemia sequence 1 (BCL2-related)	Affinity Capture-Western Protein-peptide Reconstituted Complex Two-hybrid	BioGRID	10837489 \|15077116 \|15637055 \|15901672
MYCBP2	DKFZp686M08244 \| FLJ10106 \| FLJ13826 \| FLJ21597 \| FLJ21646 \| KIAA0916 \| PAM	MYC binding protein 2	Affinity Capture-MS	BioGRID	17353931
SRRM2	300-KD \| CWF21 \| DKFZp686O15166 \| FLJ21926 \| FLJ22250 \| KIAA0324 \| MGC40295 \| SRL300 \| SRm300	serine/arginine repetitive matrix 2	Affinity Capture-MS	BioGRID	17353931
TP53	FLJ92943 \| LFS1 \| TRP53 \| p53	tumor protein p53	Mitochondrial p53-P72 interacts with Bak.	BIND	15077116
TP53	FLJ92943 \| LFS1 \| TRP53 \| p53	tumor protein p53	Mitochondrial p53-R72 interacts with Bak.	BIND	15077116
TP53	FLJ92943 \| LFS1 \| TRP53 \| p53	tumor protein p53	Affinity Capture-MS Affinity Capture-Western Reconstituted Complex	BioGRID	15077116
VDAC2	FLJ23841	voltage-dependent anion channel 2	-	HPRD,BioGRID	12881569

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
BIOCARTA MITOCHONDRIA PATHWAY	21	15	All SZGR 2.0 genes in this pathway
SA PROGRAMMED CELL DEATH	12	9	All SZGR 2.0 genes in this pathway
ST FAS SIGNALING PATHWAY	65	54	All SZGR 2.0 genes in this pathway
PID P73PATHWAY	79	59	All SZGR 2.0 genes in this pathway
PID P53 DOWNSTREAM PATHWAY	137	94	All SZGR 2.0 genes in this pathway
REACTOME APOPTOSIS	148	94	All SZGR 2.0 genes in this pathway
REACTOME INTRINSIC PATHWAY FOR APOPTOSIS	30	21	All SZGR 2.0 genes in this pathway
KIM WT1 TARGETS 12HR UP	162	116	All SZGR 2.0 genes in this pathway
ELVIDGE HYPOXIA DN	146	94	All SZGR 2.0 genes in this pathway
CONCANNON APOPTOSIS BY EPOXOMICIN UP	239	157	All SZGR 2.0 genes in this pathway
WANG ESOPHAGUS CANCER VS NORMAL UP	121	72	All SZGR 2.0 genes in this pathway
MARKS HDAC TARGETS UP	23	15	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 TTD UP	64	39	All SZGR 2.0 genes in this pathway
GALLUZZI PERMEABILIZE MITOCHONDRIA	43	31	All SZGR 2.0 genes in this pathway
GALLUZZI PREVENT MITOCHONDIAL PERMEABILIZATION	22	16	All SZGR 2.0 genes in this pathway
PATIL LIVER CANCER	747	453	All SZGR 2.0 genes in this pathway
DACOSTA UV RESPONSE VIA ERCC3 UP	309	199	All SZGR 2.0 genes in this pathway
RICKMAN TUMOR DIFFERENTIATED WELL VS POORLY DN	382	224	All SZGR 2.0 genes in this pathway
RICKMAN METASTASIS DN	261	155	All SZGR 2.0 genes in this pathway
ZEILSTRA CD44 TARGETS DN	7	5	All SZGR 2.0 genes in this pathway
STANELLE E2F1 TARGETS	29	20	All SZGR 2.0 genes in this pathway
KANNAN TP53 TARGETS UP	58	40	All SZGR 2.0 genes in this pathway
FRASOR RESPONSE TO ESTRADIOL DN	82	52	All SZGR 2.0 genes in this pathway
TENEDINI MEGAKARYOCYTE MARKERS	66	48	All SZGR 2.0 genes in this pathway
TARTE PLASMA CELL VS PLASMABLAST DN	309	206	All SZGR 2.0 genes in this pathway
DER IFN GAMMA RESPONSE UP	71	45	All SZGR 2.0 genes in this pathway
AFFAR YY1 TARGETS UP	214	133	All SZGR 2.0 genes in this pathway
WEIGEL OXIDATIVE STRESS BY TBH AND H2O2	36	24	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 20HR UP	240	152	All SZGR 2.0 genes in this pathway
TAKAO RESPONSE TO UVB RADIATION UP	86	55	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 16HR UP	225	139	All SZGR 2.0 genes in this pathway
KAYO CALORIE RESTRICTION MUSCLE DN	87	59	All SZGR 2.0 genes in this pathway
MACLACHLAN BRCA1 TARGETS DN	16	12	All SZGR 2.0 genes in this pathway
MOREIRA RESPONSE TO TSA UP	28	23	All SZGR 2.0 genes in this pathway
BRACHAT RESPONSE TO CAMPTOTHECIN DN	46	31	All SZGR 2.0 genes in this pathway
MAHAJAN RESPONSE TO IL1A UP	81	52	All SZGR 2.0 genes in this pathway
FOSTER TOLERANT MACROPHAGE UP	156	92	All SZGR 2.0 genes in this pathway
BLUM RESPONSE TO SALIRASIB UP	245	159	All SZGR 2.0 genes in this pathway
MUELLER PLURINET	299	189	All SZGR 2.0 genes in this pathway
MOOTHA HUMAN MITODB 6 2002	429	260	All SZGR 2.0 genes in this pathway
MOOTHA MITOCHONDRIA	447	277	All SZGR 2.0 genes in this pathway
ZHANG TLX TARGETS 36HR UP	221	150	All SZGR 2.0 genes in this pathway
YAMASHITA LIVER CANCER STEM CELL UP	47	38	All SZGR 2.0 genes in this pathway
FONTAINE PAPILLARY THYROID CARCINOMA DN	80	53	All SZGR 2.0 genes in this pathway
WORSCHECH TUMOR EVASION AND TOLEROGENICITY DN	14	11	All SZGR 2.0 genes in this pathway
MIKKELSEN ES ICP WITH H3K4ME3	718	401	All SZGR 2.0 genes in this pathway
MIKKELSEN NPC ICP WITH H3K4ME3	445	257	All SZGR 2.0 genes in this pathway
DUTERTRE ESTRADIOL RESPONSE 6HR DN	91	56	All SZGR 2.0 genes in this pathway
DUTERTRE ESTRADIOL RESPONSE 24HR DN	505	328	All SZGR 2.0 genes in this pathway
PURBEY TARGETS OF CTBP1 NOT SATB1 DN	448	282	All SZGR 2.0 genes in this pathway
GOBERT OLIGODENDROCYTE DIFFERENTIATION DN	1080	713	All SZGR 2.0 genes in this pathway
FORTSCHEGGER PHF8 TARGETS DN	784	464	All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY	1839	928	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-125/351	630	637	1A,m8	hsa-miR-125b^brain	UCCCUGAGACCCUAACUUGUGA
miR-125/351	630	637	1A,m8	hsa-miR-125a^brain	UCCCUGAGACCCUUUAACCUGUG
miR-26	1032	1039	1A,m8	hsa-miR-26a^brain	UUCAAGUAAUCCAGGAUAGGC
miR-26	1032	1039	1A,m8	hsa-miR-26b^SZ	UUCAAGUAAUUCAGGAUAGGUU
miR-29	188	195	1A,m8	hsa-miR-29a^SZ	UAGCACCAUCUGAAAUCGGUU
				hsa-miR-29b^SZ	UAGCACCAUUUGAAAUCAGUGUU
				hsa-miR-29c^SZ	UAGCACCAUUUGAAAUCGGU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: BAK1