SZGR2

Summary ?

GeneID	5873
Symbol	RAB27A
Synonyms	GS2\|HsT18676\|RAB27\|RAM
Description	RAB27A, member RAS oncogene family
Reference	MIM:603868\|HGNC:HGNC:9766\|Ensembl:ENSG00000069974\|HPRD:04845\|Vega:OTTHUMG00000131959
Gene type	protein-coding
Map location	15q21.3
Pascal p-value	0.005
DEG p-value	DEG:Sanders_2014:DS1_p=0.142:DS1_beta=0.042400:DS2_p=2.18e-02:DS2_beta=0.114:DS2_FDR=1.20e-01
Fetal beta	-0.054
DMG	1 (# studies)
eGene	Cerebellar Hemisphere Cerebellum Cortex Nucleus accumbens basal ganglia Meta

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DEG:Sanders_2013	Microarray	Whole-genome gene expression profiles using microarrays on lymphoblastoid cell lines (LCLs) from 413 cases and 446 controls.
DMG:Jaffe_2016	Genome-wide DNA methylation analysis	This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05.	2
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg06032813	15	55582570	RAB27A	4.26E-8	-0.016	1.18E-5	DMG:Jaffe_2016
cg15345126	15	55582248	RAB27A	6.61E-8	-0.01	1.63E-5	DMG:Jaffe_2016

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
PNPLA6	0.90	0.88
DCTN1	0.90	0.89
ABCF3	0.90	0.88
OTUD5	0.89	0.89
CACNB1	0.88	0.87
ENO2	0.88	0.88
MAPK8IP3	0.88	0.86
C17orf28	0.88	0.85
APLP1	0.88	0.88
ADRBK1	0.88	0.87

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AF347015.21	-0.68	-0.52
AF347015.31	-0.59	-0.47
MT-CO2	-0.59	-0.46
GNG11	-0.59	-0.49
AF347015.8	-0.58	-0.45
C1orf54	-0.58	-0.51
AP002478.3	-0.57	-0.50
NOSTRIN	-0.56	-0.44
AF347015.2	-0.56	-0.39
AF347015.18	-0.56	-0.42

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000166	nucleotide binding	IEA		-
GO:0003924	GTPase activity	TAS		9066979
GO:0005515	protein binding	IEA		-
GO:0005525	GTP binding	IEA		-
GO:0031489	myosin V binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007596	blood coagulation	IEA		-
GO:0007264	small GTPase mediated signal transduction	IEA		-
GO:0006605	protein targeting	IEA		-
GO:0016192	vesicle-mediated transport	IEA		-
GO:0015031	protein transport	IEA		-
GO:0043473	pigmentation	IEA		-
GO:0032402	melanosome transport	IEA		-
GO:0032400	melanosome localization	IEA		-
GO:0030318	melanocyte differentiation	IEA		-
GO:0043320	natural killer cell degranulation	IEA		-
GO:0043316	cytotoxic T cell degranulation	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0030425	dendrite	IDA	neuron, axon, dendrite (GO term level: 6)	11266474
GO:0001750	photoreceptor outer segment	IEA		-
GO:0005794	Golgi apparatus	IEA		-
GO:0005737	cytoplasm	IDA		18029348
GO:0016020	membrane	IEA		-
GO:0042470	melanosome	IDA		11266474
GO:0030141	secretory granule	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
C14orf1	ERG28 \| NET51	chromosome 14 open reading frame 1	Two-hybrid	BioGRID	16169070
C1orf103	FLJ11269 \| RIF1 \| RP11-96K19.1	chromosome 1 open reading frame 103	Two-hybrid	BioGRID	16169070
C7orf64	DKFZP564O0523 \| DKFZp686D1651 \| HSPC304	chromosome 7 open reading frame 64	Two-hybrid	BioGRID	16169070
COPS6	CSN6 \| MOV34-34KD	COP9 constitutive photomorphogenic homolog subunit 6 (Arabidopsis)	Two-hybrid	BioGRID	16169070
EEF1A1	CCS-3 \| CCS3 \| EEF-1 \| EEF1A \| EF-Tu \| EF1A \| FLJ25721 \| GRAF-1EF \| HNGC:16303 \| LENG7 \| MGC102687 \| MGC131894 \| MGC16224 \| PTI1 \| eEF1A-1	eukaryotic translation elongation factor 1 alpha 1	Two-hybrid	BioGRID	16169070
EXPH5	DKFZp781H0795 \| KIAA0624 \| MGC133291 \| MGC134967 \| SLAC2-B	exophilin 5	Affinity Capture-Western	BioGRID	11773082
GDF9	-	growth differentiation factor 9	Two-hybrid	BioGRID	16169070
GZMB	CCPI \| CGL-1 \| CGL1 \| CSP-B \| CSPB \| CTLA1 \| CTSGL1 \| HLP \| SECT	granzyme B (granzyme 2, cytotoxic T-lymphocyte-associated serine esterase 1)	-	HPRD	11266473
KIAA1377	-	KIAA1377	Two-hybrid	BioGRID	16169070
MLPH	MGC2771 \| MGC59733 \| SLAC2-A	melanophilin	-	HPRD	11773082 \|11856727 \|11980908 \|12062444 \|15059972
MLPH	MGC2771 \| MGC59733 \| SLAC2-A	melanophilin	Affinity Capture-Western Reconstituted Complex Two-hybrid	BioGRID	11773082 \|11980908 \|12062444 \|15059972
MYO5A	GS1 \| MYH12 \| MYO5 \| MYR12	myosin VA (heavy chain 12, myoxin)	-	HPRD,BioGRID	12006666
MYRIP	DKFZp586F1018 \| FLJ44025 \| MGC130034 \| MGC130035 \| SLAC2-C \| SLAC2C	myosin VIIA and Rab interacting protein	-	HPRD,BioGRID	12590134
RPH3A	KIAA0985	rabphilin 3A homolog (mouse)	Affinity Capture-Western	BioGRID	12578829
RPH3AL	NOC2	rabphilin 3A-like (without C2 domains)	-	HPRD,BioGRID	12578829
STX1A	HPC-1 \| STX1 \| p35-1	syntaxin 1A (brain)	-	HPRD	12101244
SYTL1	FLJ14996 \| JFC1 \| SLP1	synaptotagmin-like 1	-	HPRD,BioGRID	11980908
SYTL1	FLJ14996 \| JFC1 \| SLP1	synaptotagmin-like 1	-	HPRD	12590134
SYTL2	CHR11SYT \| KIAA1597 \| MGC102768 \| SGA72M \| SLP2	synaptotagmin-like 2	-	HPRD	11773082 \|12590134
SYTL2	CHR11SYT \| KIAA1597 \| MGC102768 \| SGA72M \| SLP2	synaptotagmin-like 2	-	HPRD,BioGRID	11773082
SYTL3	MGC105130 \| MGC118883 \| MGC118884 \| MGC118885 \| SLP3	synaptotagmin-like 3	-	HPRD,BioGRID	11773082 \|12590134
SYTL4	DKFZp451P0116 \| FLJ40960 \| SLP4	synaptotagmin-like 4	-	HPRD	11773082\|11865063
SYTL4	DKFZp451P0116 \| FLJ40960 \| SLP4	synaptotagmin-like 4	Affinity Capture-Western Reconstituted Complex Two-hybrid	BioGRID	11773082 \|11865063 \|12101244 \|12176990 \|12590134
SYTL5	slp5	synaptotagmin-like 5	-	HPRD,BioGRID	12051743
UNC13D	FHL3 \| HLH3 \| HPLH3 \| Munc13-4	unc-13 homolog D (C. elegans)	Reconstituted Complex	BioGRID	14699162
ZBTB16	PLZF \| ZNF145	zinc finger and BTB domain containing 16	Two-hybrid	BioGRID	16169070

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
BIOCARTA RAB PATHWAY	12	8	All SZGR 2.0 genes in this pathway
REACTOME DIABETES PATHWAYS	133	91	All SZGR 2.0 genes in this pathway
REACTOME INSULIN SYNTHESIS AND PROCESSING	21	15	All SZGR 2.0 genes in this pathway
GAZDA DIAMOND BLACKFAN ANEMIA ERYTHROID DN	493	298	All SZGR 2.0 genes in this pathway
TURASHVILI BREAST DUCTAL CARCINOMA VS DUCTAL NORMAL DN	198	110	All SZGR 2.0 genes in this pathway
FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS UP	579	346	All SZGR 2.0 genes in this pathway
SAMOLS TARGETS OF KHSV MIRNAS DN	62	35	All SZGR 2.0 genes in this pathway
DEURIG T CELL PROLYMPHOCYTIC LEUKEMIA DN	320	184	All SZGR 2.0 genes in this pathway
GRABARCZYK BCL11B TARGETS UP	81	40	All SZGR 2.0 genes in this pathway
VECCHI GASTRIC CANCER EARLY DN	367	220	All SZGR 2.0 genes in this pathway
OSMAN BLADDER CANCER UP	404	246	All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 1 UP	380	236	All SZGR 2.0 genes in this pathway
DELYS THYROID CANCER UP	443	294	All SZGR 2.0 genes in this pathway
BARRIER CANCER RELAPSE NORMAL SAMPLE UP	32	21	All SZGR 2.0 genes in this pathway
HAMAI APOPTOSIS VIA TRAIL UP	584	356	All SZGR 2.0 genes in this pathway
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN DN	584	395	All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS DN	848	527	All SZGR 2.0 genes in this pathway
BUYTAERT PHOTODYNAMIC THERAPY STRESS DN	637	377	All SZGR 2.0 genes in this pathway
GEORGES TARGETS OF MIR192 AND MIR215	893	528	All SZGR 2.0 genes in this pathway
WANG PROSTATE CANCER ANDROGEN INDEPENDENT	66	37	All SZGR 2.0 genes in this pathway
FLECHNER BIOPSY KIDNEY TRANSPLANT REJECTED VS OK UP	87	58	All SZGR 2.0 genes in this pathway
WIELAND UP BY HBV INFECTION	101	66	All SZGR 2.0 genes in this pathway
TARTE PLASMA CELL VS PLASMABLAST DN	309	206	All SZGR 2.0 genes in this pathway
HALMOS CEBPA TARGETS UP	52	34	All SZGR 2.0 genes in this pathway
AFFAR YY1 TARGETS DN	234	137	All SZGR 2.0 genes in this pathway
VERNELL RETINOBLASTOMA PATHWAY UP	70	47	All SZGR 2.0 genes in this pathway
BASSO CD40 SIGNALING UP	101	76	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 18HR UP	178	111	All SZGR 2.0 genes in this pathway
SONG TARGETS OF IE86 CMV PROTEIN	60	42	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 24HR UP	148	96	All SZGR 2.0 genes in this pathway
WANG SMARCE1 TARGETS UP	280	183	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 6HR UP	953	554	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 24HR UP	783	442	All SZGR 2.0 genes in this pathway
CREIGHTON ENDOCRINE THERAPY RESISTANCE 3	720	440	All SZGR 2.0 genes in this pathway
ZHANG GATA6 TARGETS DN	64	46	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 TARGETS UP	673	430	All SZGR 2.0 genes in this pathway
MARTINEZ TP53 TARGETS UP	602	364	All SZGR 2.0 genes in this pathway
MARTINEZ RB1 AND TP53 TARGETS UP	601	369	All SZGR 2.0 genes in this pathway
BHATI G2M ARREST BY 2METHOXYESTRADIOL UP	125	68	All SZGR 2.0 genes in this pathway
PARK APL PATHOGENESIS DN	50	35	All SZGR 2.0 genes in this pathway
SHEDDEN LUNG CANCER GOOD SURVIVAL A4	196	124	All SZGR 2.0 genes in this pathway
BOYAULT LIVER CANCER SUBCLASS G6 DN	19	13	All SZGR 2.0 genes in this pathway
BOYAULT LIVER CANCER SUBCLASS G56 DN	17	9	All SZGR 2.0 genes in this pathway
CHIANG LIVER CANCER SUBCLASS CTNNB1 DN	170	105	All SZGR 2.0 genes in this pathway
SETLUR PROSTATE CANCER TMPRSS2 ERG FUSION DN	20	12	All SZGR 2.0 genes in this pathway
CAIRO HEPATOBLASTOMA DN	267	160	All SZGR 2.0 genes in this pathway
WONG ADULT TISSUE STEM MODULE	721	492	All SZGR 2.0 genes in this pathway
SASSON RESPONSE TO GONADOTROPHINS UP	91	59	All SZGR 2.0 genes in this pathway
SASSON RESPONSE TO FORSKOLIN UP	90	58	All SZGR 2.0 genes in this pathway
KAMIKUBO MYELOID MN1 NETWORK	19	14	All SZGR 2.0 genes in this pathway
VERHAAK GLIOBLASTOMA MESENCHYMAL	216	130	All SZGR 2.0 genes in this pathway
CHICAS RB1 TARGETS SENESCENT	572	352	All SZGR 2.0 genes in this pathway
CHICAS RB1 TARGETS LOW SERUM	100	51	All SZGR 2.0 genes in this pathway
OHGUCHI LIVER HNF4A TARGETS UP	44	30	All SZGR 2.0 genes in this pathway
CHYLA CBFA2T3 TARGETS UP	387	225	All SZGR 2.0 genes in this pathway
MIYAGAWA TARGETS OF EWSR1 ETS FUSIONS DN	229	135	All SZGR 2.0 genes in this pathway
SERVITJA LIVER HNF1A TARGETS UP	135	96	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-124.1	338	345	1A,m8	hsa-miR-124a	UUAAGGCACGCGGUGAAUGCCA
miR-124/506	338	344	1A	hsa-miR-506	UAAGGCACCCUUCUGAGUAGA
miR-124/506	338	344	1A	hsa-miR-124^brain	UAAGGCACGCGGUGAAUGCC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: RAB27A