Gene Page: RARA
Summary ?
GeneID | 5914 |
Symbol | RARA |
Synonyms | NR1B1|RAR |
Description | retinoic acid receptor alpha |
Reference | MIM:180240|HGNC:HGNC:9864|Ensembl:ENSG00000131759|HPRD:06769|Vega:OTTHUMG00000133328 |
Gene type | protein-coding |
Map location | 17q21 |
Pascal p-value | 0.168 |
Sherlock p-value | 0.21 |
Fetal beta | -0.445 |
DMG | 1 (# studies) |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 2 |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg08580254 | 17 | 38478807 | RARA | 1.544E-4 | 0.271 | 0.032 | DMG:Wockner_2014 |
cg19314352 | 17 | 38501397 | RARA | 2.395E-4 | 0.537 | 0.037 | DMG:Wockner_2014 |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003700 | transcription factor activity | IEA | - | |
GO:0003707 | steroid hormone receptor activity | IEA | - | |
GO:0003708 | retinoic acid receptor activity | IEA | - | |
GO:0003713 | transcription coactivator activity | IDA | 2825025 | |
GO:0001972 | retinoic acid binding | IDA | 2825025 | |
GO:0005515 | protein binding | IPI | 10866662 |16432238 |17560333 | |
GO:0008270 | zinc ion binding | IEA | - | |
GO:0046872 | metal ion binding | IEA | - | |
GO:0043565 | sequence-specific DNA binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0006355 | regulation of transcription, DNA-dependent | IEA | - | |
GO:0030520 | estrogen receptor signaling pathway | IDA | 15831516 | |
GO:0006350 | transcription | IEA | - | |
GO:0007165 | signal transduction | IDA | 2825025 | |
GO:0048384 | retinoic acid receptor signaling pathway | IMP | 17538076 | |
GO:0032689 | negative regulation of interferon-gamma production | IDA | 18416830 | |
GO:0032526 | response to retinoic acid | IMP | 17538076 | |
GO:0032754 | positive regulation of interleukin-5 production | IDA | 18416830 | |
GO:0032753 | positive regulation of interleukin-4 production | IDA | 18416830 | |
GO:0032720 | negative regulation of tumor necrosis factor production | IDA | 18416830 | |
GO:0032736 | positive regulation of interleukin-13 production | IDA | 18416830 | |
GO:0032355 | response to estradiol stimulus | IDA | 15831516 | |
GO:0045630 | positive regulation of T-helper 2 cell differentiation | IDA | 18416830 | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | IEA | - | |
GO:0009986 | cell surface | IC | 2825025 |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
ANP32A | C15orf1 | I1PP2A | LANP | MAPM | MGC119787 | MGC150373 | PHAP1 | PHAPI | PP32 | acidic (leucine-rich) nuclear phosphoprotein 32 family, member A | RAR-alpha interacts with pp32. | BIND | 15308690 |
ARNTL | BMAL1 | BMAL1c | JAP3 | MGC47515 | MOP3 | PASD3 | TIC | bHLHe5 | aryl hydrocarbon receptor nuclear translocator-like | Reconstituted Complex | BioGRID | 11439184 |
BAG1 | RAP46 | BCL2-associated athanogene | - | HPRD,BioGRID | 9642262 |
BTG1 | - | B-cell translocation gene 1, anti-proliferative | BTG1 interacts with RARA (RAR-alpha). | BIND | 15674337 |
CCND3 | - | cyclin D3 | in vitro in vivo Two-hybrid | BioGRID | 12482873 |
CDK7 | CAK1 | CDKN7 | MO15 | STK1 | p39MO15 | cyclin-dependent kinase 7 | RAR-alpha interacts with hMo15. | BIND | 15249124 |
CLOCK | KAT13D | KIAA0334 | bHLHe8 | clock homolog (mouse) | Reconstituted Complex Two-hybrid | BioGRID | 11439184 |
GADD45A | DDIT1 | GADD45 | growth arrest and DNA-damage-inducible, alpha | Affinity Capture-Western | BioGRID | 10872826 |
GADD45G | CR6 | DDIT2 | GADD45gamma | GRP17 | growth arrest and DNA-damage-inducible, gamma | Reconstituted Complex | BioGRID | 10872826 |
GATA2 | MGC2306 | NFE1B | GATA binding protein 2 | - | HPRD | 10938104 |
HDAC3 | HD3 | RPD3 | RPD3-2 | histone deacetylase 3 | Reconstituted Complex | BioGRID | 12943985 |
HDAC4 | HA6116 | HD4 | HDAC-A | HDACA | KIAA0288 | histone deacetylase 4 | Reconstituted Complex | BioGRID | 12943985 |
IRX4 | IRXA3 | MGC131996 | iroquois homeobox 4 | - | HPRD,BioGRID | 11382777 |
JARID1A | KDM5A | RBBP2 | RBP2 | jumonji, AT rich interactive domain 1A | Reconstituted Complex | BioGRID | 11358960 |
JARID1A | KDM5A | RBBP2 | RBP2 | jumonji, AT rich interactive domain 1A | Rbp2 interacts with RAR. | BIND | 11358960 |
KAT2B | CAF | P | P/CAF | PCAF | K(lysine) acetyltransferase 2B | Affinity Capture-Western | BioGRID | 14581481 |
KLF5 | BTEB2 | CKLF | IKLF | Kruppel-like factor 5 (intestinal) | in vitro in vivo | BioGRID | 12101409 |
MECR | CGI-63 | FASN2B | NRBF1 | mitochondrial trans-2-enoyl-CoA reductase | - | HPRD,BioGRID | 9795230 |
MED6 | NY-REN-28 | mediator complex subunit 6 | Med6 interacts with RAR-alpha. | BIND | 15808511 |
NCOA1 | F-SRC-1 | KAT13A | MGC129719 | MGC129720 | NCoA-1 | RIP160 | SRC-1 | SRC1 | bHLHe42 | nuclear receptor coactivator 1 | RAR-alpha interacts with SRC-1. | BIND | 15249124 |
NCOA1 | F-SRC-1 | KAT13A | MGC129719 | MGC129720 | NCoA-1 | RIP160 | SRC-1 | SRC1 | bHLHe42 | nuclear receptor coactivator 1 | - | HPRD | 12138096 |
NCOA2 | GRIP1 | KAT13C | MGC138808 | NCoA-2 | TIF2 | nuclear receptor coactivator 2 | GRIP1 interacts with RAR. This interaction was modeled on a demonstrated interaction between mouse GRIP1 and human RAR. | BIND | 9920895 |
NCOA3 | ACTR | AIB-1 | AIB1 | CAGH16 | CTG26 | KAT13B | MGC141848 | RAC3 | SRC3 | TNRC14 | TNRC16 | TRAM-1 | pCIP | nuclear receptor coactivator 3 | RAC3 interacts with RAR-alpha. | BIND | 9238002 |
NCOA6 | AIB3 | ANTP | ASC2 | HOX1.1 | HOXA7 | KIAA0181 | NRC | PRIP | RAP250 | TRBP | nuclear receptor coactivator 6 | - | HPRD,BioGRID | 10567404 |
NCOR1 | KIAA1047 | MGC104216 | N-CoR | TRAC1 | hCIT529I10 | hN-CoR | nuclear receptor co-repressor 1 | NCOR1 (N-CoR) interacts with p-RAR-alpha2 (RAR-alpha2 promoter). | BIND | 15729358 |
NCOR1 | KIAA1047 | MGC104216 | N-CoR | TRAC1 | hCIT529I10 | hN-CoR | nuclear receptor co-repressor 1 | Reconstituted Complex Two-hybrid | BioGRID | 9531570 |10336495 |
NCOR2 | CTG26 | SMRT | SMRTE | SMRTE-tau | TNRC14 | TRAC-1 | TRAC1 | nuclear receptor co-repressor 2 | Affinity Capture-Western Reconstituted Complex | BioGRID | 9256429 |11929748 |
NCOR2 | CTG26 | SMRT | SMRTE | SMRTE-tau | TNRC14 | TRAC-1 | TRAC1 | nuclear receptor co-repressor 2 | NCOR2 (SMRT) interacts with p-RAR-alpha2 (RAR-alpha2 promoter). | BIND | 15729358 |
NKX2-1 | BCH | BHC | NK-2 | NKX2.1 | NKX2A | TEBP | TITF1 | TTF-1 | TTF1 | NK2 homeobox 1 | - | HPRD,BioGRID | 10617585 |
NPAS2 | FLJ23138 | MGC71151 | MOP4 | PASD4 | bHLHe9 | neuronal PAS domain protein 2 | Reconstituted Complex Two-hybrid | BioGRID | 11439184 |
NR0B2 | FLJ17090 | SHP | SHP1 | nuclear receptor subfamily 0, group B, member 2 | - | HPRD,BioGRID | 9773978 |
NR1H3 | LXR-a | LXRA | RLD-1 | nuclear receptor subfamily 1, group H, member 3 | - | HPRD | 10022764 |
NR2E3 | ESCS | MGC49976 | PNR | RNR | RP37 | rd7 | nuclear receptor subfamily 2, group E, member 3 | - | HPRD,BioGRID | 10611353 |
NR4A2 | HZF-3 | NOT | NURR1 | RNR1 | TINUR | nuclear receptor subfamily 4, group A, member 2 | Reconstituted Complex Two-hybrid | BioGRID | 7705655 |
NRBF2 | COPR1 | COPR2 | DKFZp564C1664 | FLJ30395 | NRBF-2 | nuclear receptor binding factor 2 | - | HPRD,BioGRID | 10786636 |
NRIP1 | FLJ77253 | RIP140 | nuclear receptor interacting protein 1 | Affinity Capture-Western Reconstituted Complex | BioGRID | 8887632 |12549917 |14581481 |
NRIP1 | FLJ77253 | RIP140 | nuclear receptor interacting protein 1 | - | HPRD | 12403842 |12549917 |
NRIP2 | DKFZp761G1913 | nuclear receptor interacting protein 2 | - | HPRD | 10860982 |
NSD1 | ARA267 | DKFZp666C163 | FLJ10684 | FLJ22263 | FLJ44628 | KMT3B | SOTOS | STO | nuclear receptor binding SET domain protein 1 | - | HPRD | 9628876 |
PARP1 | ADPRT | ADPRT1 | PARP | PARP-1 | PPOL | pADPRT-1 | poly (ADP-ribose) polymerase 1 | PARP-1 interacts with RAR-alpha. | BIND | 15808511 |
PML | MYL | PP8675 | RNF71 | TRIM19 | promyelocytic leukemia | - | HPRD | 12935927 |
PML | MYL | PP8675 | RNF71 | TRIM19 | promyelocytic leukemia | Reconstituted Complex | BioGRID | 10610177 |
PNRC2 | FLJ20312 | MGC99541 | proline-rich nuclear receptor coactivator 2 | - | HPRD | 11574675 |
POU2F1 | OCT1 | OTF1 | POU class 2 homeobox 1 | Reconstituted Complex | BioGRID | 10480874 |
PRMT2 | HRMT1L1 | MGC111373 | protein arginine methyltransferase 2 | PRMT2 interacts with RAR. | BIND | 12039952 |
RARA | NR1B1 | RAR | retinoic acid receptor, alpha | Reconstituted Complex | BioGRID | 14521715 |
RBP2 | CRABP-II | CRBP2 | CRBPII | RBPC2 | retinol binding protein 2, cellular | - | HPRD | 11358960 |
RXRA | FLJ00280 | FLJ00318 | FLJ16020 | FLJ16733 | MGC102720 | NR2B1 | retinoid X receptor, alpha | Co-purification Reconstituted Complex | BioGRID | 1314167 |12052862 |
RXRB | DAUDI6 | H-2RIIBP | MGC1831 | NR2B2 | RCoR-1 | retinoid X receptor, beta | Two-hybrid | BioGRID | 16189514 |
RXRG | NR2B3 | RXRC | retinoid X receptor, gamma | Two-hybrid | BioGRID | 16189514 |
SP1 | - | Sp1 transcription factor | Reconstituted Complex | BioGRID | 10361124 |
SPEN | KIAA0929 | MINT | RP1-134O19.1 | SHARP | spen homolog, transcriptional regulator (Drosophila) | - | HPRD | 11331609 |
SRC | ASV | SRC1 | c-SRC | p60-Src | v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian) | Reconstituted Complex | BioGRID | 10454579 |
TADA3L | ADA3 | FLJ20221 | FLJ21329 | hADA3 | transcriptional adaptor 3 (NGG1 homolog, yeast)-like | - | HPRD,BioGRID | 12235159 |
TDG | - | thymine-DNA glycosylase | Reconstituted Complex | BioGRID | 12874288 |
TNFRSF10B | CD262 | DR5 | KILLER | KILLER/DR5 | TRAIL-R2 | TRAILR2 | TRICK2 | TRICK2A | TRICK2B | TRICKB | ZTNFR9 | tumor necrosis factor receptor superfamily, member 10b | RARA (RAR-alpha) interacts with TNFRSF10B (DR5) RARE. | BIND | 12805378 |
TRIM24 | PTC6 | RNF82 | TF1A | TIF1 | TIF1A | TIF1ALPHA | hTIF1 | tripartite motif-containing 24 | Reconstituted Complex | BioGRID | 9115274 |
TRIP4 | HsT17391 | thyroid hormone receptor interactor 4 | - | HPRD,BioGRID | 10454579 |
ZBTB16 | PLZF | ZNF145 | zinc finger and BTB domain containing 16 | - | HPRD,BioGRID | 14521715 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG PATHWAYS IN CANCER | 328 | 259 | All SZGR 2.0 genes in this pathway |
KEGG ACUTE MYELOID LEUKEMIA | 60 | 47 | All SZGR 2.0 genes in this pathway |
BIOCARTA EGFR SMRTE PATHWAY | 11 | 11 | All SZGR 2.0 genes in this pathway |
BIOCARTA RARRXR PATHWAY | 15 | 9 | All SZGR 2.0 genes in this pathway |
BIOCARTA NUCLEARRS PATHWAY | 15 | 12 | All SZGR 2.0 genes in this pathway |
BIOCARTA PML PATHWAY | 17 | 12 | All SZGR 2.0 genes in this pathway |
BIOCARTA CARM1 PATHWAY | 13 | 11 | All SZGR 2.0 genes in this pathway |
PID RXR VDR PATHWAY | 26 | 24 | All SZGR 2.0 genes in this pathway |
PID RETINOIC ACID PATHWAY | 30 | 23 | All SZGR 2.0 genes in this pathway |
REACTOME GENERIC TRANSCRIPTION PATHWAY | 352 | 181 | All SZGR 2.0 genes in this pathway |
REACTOME NUCLEAR RECEPTOR TRANSCRIPTION PATHWAY | 49 | 36 | All SZGR 2.0 genes in this pathway |
FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS DN | 463 | 290 | All SZGR 2.0 genes in this pathway |
THUM SYSTOLIC HEART FAILURE UP | 423 | 283 | All SZGR 2.0 genes in this pathway |
SMIRNOV CIRCULATING ENDOTHELIOCYTES IN CANCER UP | 158 | 103 | All SZGR 2.0 genes in this pathway |
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 6HR DN | 41 | 29 | All SZGR 2.0 genes in this pathway |
MULLIGHAN NPM1 MUTATED SIGNATURE 1 DN | 126 | 86 | All SZGR 2.0 genes in this pathway |
MULLIGHAN NPM1 MUTATED SIGNATURE 2 DN | 77 | 46 | All SZGR 2.0 genes in this pathway |
MULLIGHAN NPM1 SIGNATURE 3 DN | 162 | 116 | All SZGR 2.0 genes in this pathway |
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION HSC DN | 187 | 115 | All SZGR 2.0 genes in this pathway |
UDAYAKUMAR MED1 TARGETS DN | 240 | 171 | All SZGR 2.0 genes in this pathway |
TIEN INTESTINE PROBIOTICS 24HR DN | 214 | 133 | All SZGR 2.0 genes in this pathway |
NAGASHIMA NRG1 SIGNALING UP | 176 | 123 | All SZGR 2.0 genes in this pathway |
KIM WT1 TARGETS UP | 214 | 155 | All SZGR 2.0 genes in this pathway |
GOZGIT ESR1 TARGETS DN | 781 | 465 | All SZGR 2.0 genes in this pathway |
LINDGREN BLADDER CANCER CLUSTER 1 UP | 121 | 71 | All SZGR 2.0 genes in this pathway |
BERENJENO TRANSFORMED BY RHOA DN | 394 | 258 | All SZGR 2.0 genes in this pathway |
LINDGREN BLADDER CANCER WITH LOH IN CHR9Q | 116 | 71 | All SZGR 2.0 genes in this pathway |
FARMER BREAST CANCER BASAL VS LULMINAL | 330 | 215 | All SZGR 2.0 genes in this pathway |
YORDY RECIPROCAL REGULATION BY ETS1 AND SP100 UP | 25 | 11 | All SZGR 2.0 genes in this pathway |
SCHLESINGER METHYLATED DE NOVO IN CANCER | 88 | 64 | All SZGR 2.0 genes in this pathway |
LOPEZ MBD TARGETS | 957 | 597 | All SZGR 2.0 genes in this pathway |
BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
NIKOLSKY BREAST CANCER 17Q11 Q21 AMPLICON | 133 | 78 | All SZGR 2.0 genes in this pathway |
BYSTROEM CORRELATED WITH IL5 DN | 64 | 47 | All SZGR 2.0 genes in this pathway |
JECHLINGER EPITHELIAL TO MESENCHYMAL TRANSITION DN | 66 | 47 | All SZGR 2.0 genes in this pathway |
FERNANDEZ BOUND BY MYC | 182 | 116 | All SZGR 2.0 genes in this pathway |
HOFMANN CELL LYMPHOMA DN | 39 | 29 | All SZGR 2.0 genes in this pathway |
ABRAHAM ALPC VS MULTIPLE MYELOMA UP | 26 | 22 | All SZGR 2.0 genes in this pathway |
THEILGAARD NEUTROPHIL AT SKIN WOUND DN | 225 | 163 | All SZGR 2.0 genes in this pathway |
EHRLICH ICF SYNDROM UP | 13 | 8 | All SZGR 2.0 genes in this pathway |
MOREIRA RESPONSE TO TSA UP | 28 | 23 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 6HR UP | 953 | 554 | All SZGR 2.0 genes in this pathway |
KRIGE RESPONSE TO TOSEDOSTAT 24HR UP | 783 | 442 | All SZGR 2.0 genes in this pathway |
ACEVEDO LIVER CANCER WITH H3K9ME3 UP | 141 | 75 | All SZGR 2.0 genes in this pathway |
SMID BREAST CANCER BASAL DN | 701 | 446 | All SZGR 2.0 genes in this pathway |
BERNARD PPAPDC1B TARGETS DN | 58 | 39 | All SZGR 2.0 genes in this pathway |
MATZUK SPERMATOCYTE | 72 | 55 | All SZGR 2.0 genes in this pathway |
WEST ADRENOCORTICAL TUMOR DN | 546 | 362 | All SZGR 2.0 genes in this pathway |
GRESHOCK CANCER COPY NUMBER UP | 323 | 240 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
VANTVEER BREAST CANCER ESR1 UP | 167 | 99 | All SZGR 2.0 genes in this pathway |
TAVAZOIE METASTASIS | 108 | 68 | All SZGR 2.0 genes in this pathway |
MILI PSEUDOPODIA CHEMOTAXIS DN | 457 | 302 | All SZGR 2.0 genes in this pathway |
DANG REGULATED BY MYC DN | 253 | 192 | All SZGR 2.0 genes in this pathway |
DANG MYC TARGETS DN | 31 | 25 | All SZGR 2.0 genes in this pathway |
DANG BOUND BY MYC | 1103 | 714 | All SZGR 2.0 genes in this pathway |
MARTENS BOUND BY PML RARA FUSION | 456 | 287 | All SZGR 2.0 genes in this pathway |
GREGORY SYNTHETIC LETHAL WITH IMATINIB | 145 | 83 | All SZGR 2.0 genes in this pathway |
DUTERTRE ESTRADIOL RESPONSE 6HR UP | 229 | 149 | All SZGR 2.0 genes in this pathway |
BHAT ESR1 TARGETS NOT VIA AKT1 UP | 211 | 131 | All SZGR 2.0 genes in this pathway |
BHAT ESR1 TARGETS VIA AKT1 UP | 281 | 183 | All SZGR 2.0 genes in this pathway |
BRUINS UVC RESPONSE VIA TP53 GROUP D | 280 | 158 | All SZGR 2.0 genes in this pathway |
KASLER HDAC7 TARGETS 1 UP | 194 | 133 | All SZGR 2.0 genes in this pathway |
DUAN PRDM5 TARGETS | 79 | 52 | All SZGR 2.0 genes in this pathway |
PURBEY TARGETS OF CTBP1 AND SATB1 UP | 87 | 52 | All SZGR 2.0 genes in this pathway |
WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D | 658 | 397 | All SZGR 2.0 genes in this pathway |
VANOEVELEN MYOGENESIS SIN3A TARGETS | 220 | 133 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-128 | 739 | 745 | 1A | hsa-miR-128a | UCACAGUGAACCGGUCUCUUUU |
hsa-miR-128b | UCACAGUGAACCGGUCUCUUUC | ||||
miR-135 | 374 | 380 | m8 | hsa-miR-135a | UAUGGCUUUUUAUUCCUAUGUGA |
hsa-miR-135b | UAUGGCUUUUCAUUCCUAUGUG | ||||
miR-138 | 329 | 336 | 1A,m8 | hsa-miR-138brain | AGCUGGUGUUGUGAAUC |
hsa-miR-138brain | AGCUGGUGUUGUGAAUC | ||||
miR-205 | 578 | 584 | 1A | hsa-miR-205 | UCCUUCAUUCCACCGGAGUCUG |
miR-218 | 564 | 570 | m8 | hsa-miR-218brain | UUGUGCUUGAUCUAACCAUGU |
miR-27 | 739 | 746 | 1A,m8 | hsa-miR-27abrain | UUCACAGUGGCUAAGUUCCGC |
hsa-miR-27bbrain | UUCACAGUGGCUAAGUUCUGC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.