SZGR2

Summary ?

GeneID	5914
Symbol	RARA
Synonyms	NR1B1\|RAR
Description	retinoic acid receptor alpha
Reference	MIM:180240\|HGNC:HGNC:9864\|Ensembl:ENSG00000131759\|HPRD:06769\|Vega:OTTHUMG00000133328
Gene type	protein-coding
Map location	17q21
Pascal p-value	0.168
Sherlock p-value	0.21
Fetal beta	-0.445
DMG	1 (# studies)

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	2
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias	Click to show details

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg08580254	17	38478807	RARA	1.544E-4	0.271	0.032	DMG:Wockner_2014
cg19314352	17	38501397	RARA	2.395E-4	0.537	0.037	DMG:Wockner_2014

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003700	transcription factor activity	IEA		-
GO:0003707	steroid hormone receptor activity	IEA		-
GO:0003708	retinoic acid receptor activity	IEA		-
GO:0003713	transcription coactivator activity	IDA		2825025
GO:0001972	retinoic acid binding	IDA		2825025
GO:0005515	protein binding	IPI		10866662 \|16432238 \|17560333
GO:0008270	zinc ion binding	IEA		-
GO:0046872	metal ion binding	IEA		-
GO:0043565	sequence-specific DNA binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006355	regulation of transcription, DNA-dependent	IEA		-
GO:0030520	estrogen receptor signaling pathway	IDA		15831516
GO:0006350	transcription	IEA		-
GO:0007165	signal transduction	IDA		2825025
GO:0048384	retinoic acid receptor signaling pathway	IMP		17538076
GO:0032689	negative regulation of interferon-gamma production	IDA		18416830
GO:0032526	response to retinoic acid	IMP		17538076
GO:0032754	positive regulation of interleukin-5 production	IDA		18416830
GO:0032753	positive regulation of interleukin-4 production	IDA		18416830
GO:0032720	negative regulation of tumor necrosis factor production	IDA		18416830
GO:0032736	positive regulation of interleukin-13 production	IDA		18416830
GO:0032355	response to estradiol stimulus	IDA		15831516
GO:0045630	positive regulation of T-helper 2 cell differentiation	IDA		18416830
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	IEA		-
GO:0009986	cell surface	IC		2825025

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ANP32A	C15orf1 \| I1PP2A \| LANP \| MAPM \| MGC119787 \| MGC150373 \| PHAP1 \| PHAPI \| PP32	acidic (leucine-rich) nuclear phosphoprotein 32 family, member A	RAR-alpha interacts with pp32.	BIND	15308690
ARNTL	BMAL1 \| BMAL1c \| JAP3 \| MGC47515 \| MOP3 \| PASD3 \| TIC \| bHLHe5	aryl hydrocarbon receptor nuclear translocator-like	Reconstituted Complex	BioGRID	11439184
BAG1	RAP46	BCL2-associated athanogene	-	HPRD,BioGRID	9642262
BTG1	-	B-cell translocation gene 1, anti-proliferative	BTG1 interacts with RARA (RAR-alpha).	BIND	15674337
CCND3	-	cyclin D3	in vitro in vivo Two-hybrid	BioGRID	12482873
CDK7	CAK1 \| CDKN7 \| MO15 \| STK1 \| p39MO15	cyclin-dependent kinase 7	RAR-alpha interacts with hMo15.	BIND	15249124
CLOCK	KAT13D \| KIAA0334 \| bHLHe8	clock homolog (mouse)	Reconstituted Complex Two-hybrid	BioGRID	11439184
GADD45A	DDIT1 \| GADD45	growth arrest and DNA-damage-inducible, alpha	Affinity Capture-Western	BioGRID	10872826
GADD45G	CR6 \| DDIT2 \| GADD45gamma \| GRP17	growth arrest and DNA-damage-inducible, gamma	Reconstituted Complex	BioGRID	10872826
GATA2	MGC2306 \| NFE1B	GATA binding protein 2	-	HPRD	10938104
HDAC3	HD3 \| RPD3 \| RPD3-2	histone deacetylase 3	Reconstituted Complex	BioGRID	12943985
HDAC4	HA6116 \| HD4 \| HDAC-A \| HDACA \| KIAA0288	histone deacetylase 4	Reconstituted Complex	BioGRID	12943985
IRX4	IRXA3 \| MGC131996	iroquois homeobox 4	-	HPRD,BioGRID	11382777
JARID1A	KDM5A \| RBBP2 \| RBP2	jumonji, AT rich interactive domain 1A	Reconstituted Complex	BioGRID	11358960
JARID1A	KDM5A \| RBBP2 \| RBP2	jumonji, AT rich interactive domain 1A	Rbp2 interacts with RAR.	BIND	11358960
KAT2B	CAF \| P \| P/CAF \| PCAF	K(lysine) acetyltransferase 2B	Affinity Capture-Western	BioGRID	14581481
KLF5	BTEB2 \| CKLF \| IKLF	Kruppel-like factor 5 (intestinal)	in vitro in vivo	BioGRID	12101409
MECR	CGI-63 \| FASN2B \| NRBF1	mitochondrial trans-2-enoyl-CoA reductase	-	HPRD,BioGRID	9795230
MED6	NY-REN-28	mediator complex subunit 6	Med6 interacts with RAR-alpha.	BIND	15808511
NCOA1	F-SRC-1 \| KAT13A \| MGC129719 \| MGC129720 \| NCoA-1 \| RIP160 \| SRC-1 \| SRC1 \| bHLHe42	nuclear receptor coactivator 1	RAR-alpha interacts with SRC-1.	BIND	15249124
NCOA1	F-SRC-1 \| KAT13A \| MGC129719 \| MGC129720 \| NCoA-1 \| RIP160 \| SRC-1 \| SRC1 \| bHLHe42	nuclear receptor coactivator 1	-	HPRD	12138096
NCOA2	GRIP1 \| KAT13C \| MGC138808 \| NCoA-2 \| TIF2	nuclear receptor coactivator 2	GRIP1 interacts with RAR. This interaction was modeled on a demonstrated interaction between mouse GRIP1 and human RAR.	BIND	9920895
NCOA3	ACTR \| AIB-1 \| AIB1 \| CAGH16 \| CTG26 \| KAT13B \| MGC141848 \| RAC3 \| SRC3 \| TNRC14 \| TNRC16 \| TRAM-1 \| pCIP	nuclear receptor coactivator 3	RAC3 interacts with RAR-alpha.	BIND	9238002
NCOA6	AIB3 \| ANTP \| ASC2 \| HOX1.1 \| HOXA7 \| KIAA0181 \| NRC \| PRIP \| RAP250 \| TRBP	nuclear receptor coactivator 6	-	HPRD,BioGRID	10567404
NCOR1	KIAA1047 \| MGC104216 \| N-CoR \| TRAC1 \| hCIT529I10 \| hN-CoR	nuclear receptor co-repressor 1	NCOR1 (N-CoR) interacts with p-RAR-alpha2 (RAR-alpha2 promoter).	BIND	15729358
NCOR1	KIAA1047 \| MGC104216 \| N-CoR \| TRAC1 \| hCIT529I10 \| hN-CoR	nuclear receptor co-repressor 1	Reconstituted Complex Two-hybrid	BioGRID	9531570 \|10336495
NCOR2	CTG26 \| SMRT \| SMRTE \| SMRTE-tau \| TNRC14 \| TRAC-1 \| TRAC1	nuclear receptor co-repressor 2	Affinity Capture-Western Reconstituted Complex	BioGRID	9256429 \|11929748
NCOR2	CTG26 \| SMRT \| SMRTE \| SMRTE-tau \| TNRC14 \| TRAC-1 \| TRAC1	nuclear receptor co-repressor 2	NCOR2 (SMRT) interacts with p-RAR-alpha2 (RAR-alpha2 promoter).	BIND	15729358
NKX2-1	BCH \| BHC \| NK-2 \| NKX2.1 \| NKX2A \| TEBP \| TITF1 \| TTF-1 \| TTF1	NK2 homeobox 1	-	HPRD,BioGRID	10617585
NPAS2	FLJ23138 \| MGC71151 \| MOP4 \| PASD4 \| bHLHe9	neuronal PAS domain protein 2	Reconstituted Complex Two-hybrid	BioGRID	11439184
NR0B2	FLJ17090 \| SHP \| SHP1	nuclear receptor subfamily 0, group B, member 2	-	HPRD,BioGRID	9773978
NR1H3	LXR-a \| LXRA \| RLD-1	nuclear receptor subfamily 1, group H, member 3	-	HPRD	10022764
NR2E3	ESCS \| MGC49976 \| PNR \| RNR \| RP37 \| rd7	nuclear receptor subfamily 2, group E, member 3	-	HPRD,BioGRID	10611353
NR4A2	HZF-3 \| NOT \| NURR1 \| RNR1 \| TINUR	nuclear receptor subfamily 4, group A, member 2	Reconstituted Complex Two-hybrid	BioGRID	7705655
NRBF2	COPR1 \| COPR2 \| DKFZp564C1664 \| FLJ30395 \| NRBF-2	nuclear receptor binding factor 2	-	HPRD,BioGRID	10786636
NRIP1	FLJ77253 \| RIP140	nuclear receptor interacting protein 1	Affinity Capture-Western Reconstituted Complex	BioGRID	8887632 \|12549917 \|14581481
NRIP1	FLJ77253 \| RIP140	nuclear receptor interacting protein 1	-	HPRD	12403842 \|12549917
NRIP2	DKFZp761G1913	nuclear receptor interacting protein 2	-	HPRD	10860982
NSD1	ARA267 \| DKFZp666C163 \| FLJ10684 \| FLJ22263 \| FLJ44628 \| KMT3B \| SOTOS \| STO	nuclear receptor binding SET domain protein 1	-	HPRD	9628876
PARP1	ADPRT \| ADPRT1 \| PARP \| PARP-1 \| PPOL \| pADPRT-1	poly (ADP-ribose) polymerase 1	PARP-1 interacts with RAR-alpha.	BIND	15808511
PML	MYL \| PP8675 \| RNF71 \| TRIM19	promyelocytic leukemia	-	HPRD	12935927
PML	MYL \| PP8675 \| RNF71 \| TRIM19	promyelocytic leukemia	Reconstituted Complex	BioGRID	10610177
PNRC2	FLJ20312 \| MGC99541	proline-rich nuclear receptor coactivator 2	-	HPRD	11574675
POU2F1	OCT1 \| OTF1	POU class 2 homeobox 1	Reconstituted Complex	BioGRID	10480874
PRMT2	HRMT1L1 \| MGC111373	protein arginine methyltransferase 2	PRMT2 interacts with RAR.	BIND	12039952
RARA	NR1B1 \| RAR	retinoic acid receptor, alpha	Reconstituted Complex	BioGRID	14521715
RBP2	CRABP-II \| CRBP2 \| CRBPII \| RBPC2	retinol binding protein 2, cellular	-	HPRD	11358960
RXRA	FLJ00280 \| FLJ00318 \| FLJ16020 \| FLJ16733 \| MGC102720 \| NR2B1	retinoid X receptor, alpha	Co-purification Reconstituted Complex	BioGRID	1314167 \|12052862
RXRB	DAUDI6 \| H-2RIIBP \| MGC1831 \| NR2B2 \| RCoR-1	retinoid X receptor, beta	Two-hybrid	BioGRID	16189514
RXRG	NR2B3 \| RXRC	retinoid X receptor, gamma	Two-hybrid	BioGRID	16189514
SP1	-	Sp1 transcription factor	Reconstituted Complex	BioGRID	10361124
SPEN	KIAA0929 \| MINT \| RP1-134O19.1 \| SHARP	spen homolog, transcriptional regulator (Drosophila)	-	HPRD	11331609
SRC	ASV \| SRC1 \| c-SRC \| p60-Src	v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian)	Reconstituted Complex	BioGRID	10454579
TADA3L	ADA3 \| FLJ20221 \| FLJ21329 \| hADA3	transcriptional adaptor 3 (NGG1 homolog, yeast)-like	-	HPRD,BioGRID	12235159
TDG	-	thymine-DNA glycosylase	Reconstituted Complex	BioGRID	12874288
TNFRSF10B	CD262 \| DR5 \| KILLER \| KILLER/DR5 \| TRAIL-R2 \| TRAILR2 \| TRICK2 \| TRICK2A \| TRICK2B \| TRICKB \| ZTNFR9	tumor necrosis factor receptor superfamily, member 10b	RARA (RAR-alpha) interacts with TNFRSF10B (DR5) RARE.	BIND	12805378
TRIM24	PTC6 \| RNF82 \| TF1A \| TIF1 \| TIF1A \| TIF1ALPHA \| hTIF1	tripartite motif-containing 24	Reconstituted Complex	BioGRID	9115274
TRIP4	HsT17391	thyroid hormone receptor interactor 4	-	HPRD,BioGRID	10454579
ZBTB16	PLZF \| ZNF145	zinc finger and BTB domain containing 16	-	HPRD,BioGRID	14521715

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG PATHWAYS IN CANCER	328	259	All SZGR 2.0 genes in this pathway
KEGG ACUTE MYELOID LEUKEMIA	60	47	All SZGR 2.0 genes in this pathway
BIOCARTA EGFR SMRTE PATHWAY	11	11	All SZGR 2.0 genes in this pathway
BIOCARTA RARRXR PATHWAY	15	9	All SZGR 2.0 genes in this pathway
BIOCARTA NUCLEARRS PATHWAY	15	12	All SZGR 2.0 genes in this pathway
BIOCARTA PML PATHWAY	17	12	All SZGR 2.0 genes in this pathway
BIOCARTA CARM1 PATHWAY	13	11	All SZGR 2.0 genes in this pathway
PID RXR VDR PATHWAY	26	24	All SZGR 2.0 genes in this pathway
PID RETINOIC ACID PATHWAY	30	23	All SZGR 2.0 genes in this pathway
REACTOME GENERIC TRANSCRIPTION PATHWAY	352	181	All SZGR 2.0 genes in this pathway
REACTOME NUCLEAR RECEPTOR TRANSCRIPTION PATHWAY	49	36	All SZGR 2.0 genes in this pathway
FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS DN	463	290	All SZGR 2.0 genes in this pathway
THUM SYSTOLIC HEART FAILURE UP	423	283	All SZGR 2.0 genes in this pathway
SMIRNOV CIRCULATING ENDOTHELIOCYTES IN CANCER UP	158	103	All SZGR 2.0 genes in this pathway
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 6HR DN	41	29	All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 MUTATED SIGNATURE 1 DN	126	86	All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 MUTATED SIGNATURE 2 DN	77	46	All SZGR 2.0 genes in this pathway
MULLIGHAN NPM1 SIGNATURE 3 DN	162	116	All SZGR 2.0 genes in this pathway
TONKS TARGETS OF RUNX1 RUNX1T1 FUSION HSC DN	187	115	All SZGR 2.0 genes in this pathway
UDAYAKUMAR MED1 TARGETS DN	240	171	All SZGR 2.0 genes in this pathway
TIEN INTESTINE PROBIOTICS 24HR DN	214	133	All SZGR 2.0 genes in this pathway
NAGASHIMA NRG1 SIGNALING UP	176	123	All SZGR 2.0 genes in this pathway
KIM WT1 TARGETS UP	214	155	All SZGR 2.0 genes in this pathway
GOZGIT ESR1 TARGETS DN	781	465	All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER CLUSTER 1 UP	121	71	All SZGR 2.0 genes in this pathway
BERENJENO TRANSFORMED BY RHOA DN	394	258	All SZGR 2.0 genes in this pathway
LINDGREN BLADDER CANCER WITH LOH IN CHR9Q	116	71	All SZGR 2.0 genes in this pathway
FARMER BREAST CANCER BASAL VS LULMINAL	330	215	All SZGR 2.0 genes in this pathway
YORDY RECIPROCAL REGULATION BY ETS1 AND SP100 UP	25	11	All SZGR 2.0 genes in this pathway
SCHLESINGER METHYLATED DE NOVO IN CANCER	88	64	All SZGR 2.0 genes in this pathway
LOPEZ MBD TARGETS	957	597	All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3	1118	744	All SZGR 2.0 genes in this pathway
NIKOLSKY BREAST CANCER 17Q11 Q21 AMPLICON	133	78	All SZGR 2.0 genes in this pathway
BYSTROEM CORRELATED WITH IL5 DN	64	47	All SZGR 2.0 genes in this pathway
JECHLINGER EPITHELIAL TO MESENCHYMAL TRANSITION DN	66	47	All SZGR 2.0 genes in this pathway
FERNANDEZ BOUND BY MYC	182	116	All SZGR 2.0 genes in this pathway
HOFMANN CELL LYMPHOMA DN	39	29	All SZGR 2.0 genes in this pathway
ABRAHAM ALPC VS MULTIPLE MYELOMA UP	26	22	All SZGR 2.0 genes in this pathway
THEILGAARD NEUTROPHIL AT SKIN WOUND DN	225	163	All SZGR 2.0 genes in this pathway
EHRLICH ICF SYNDROM UP	13	8	All SZGR 2.0 genes in this pathway
MOREIRA RESPONSE TO TSA UP	28	23	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 6HR UP	953	554	All SZGR 2.0 genes in this pathway
KRIGE RESPONSE TO TOSEDOSTAT 24HR UP	783	442	All SZGR 2.0 genes in this pathway
ACEVEDO LIVER CANCER WITH H3K9ME3 UP	141	75	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER BASAL DN	701	446	All SZGR 2.0 genes in this pathway
BERNARD PPAPDC1B TARGETS DN	58	39	All SZGR 2.0 genes in this pathway
MATZUK SPERMATOCYTE	72	55	All SZGR 2.0 genes in this pathway
WEST ADRENOCORTICAL TUMOR DN	546	362	All SZGR 2.0 genes in this pathway
GRESHOCK CANCER COPY NUMBER UP	323	240	All SZGR 2.0 genes in this pathway
YOSHIMURA MAPK8 TARGETS UP	1305	895	All SZGR 2.0 genes in this pathway
VANTVEER BREAST CANCER ESR1 UP	167	99	All SZGR 2.0 genes in this pathway
TAVAZOIE METASTASIS	108	68	All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA CHEMOTAXIS DN	457	302	All SZGR 2.0 genes in this pathway
DANG REGULATED BY MYC DN	253	192	All SZGR 2.0 genes in this pathway
DANG MYC TARGETS DN	31	25	All SZGR 2.0 genes in this pathway
DANG BOUND BY MYC	1103	714	All SZGR 2.0 genes in this pathway
MARTENS BOUND BY PML RARA FUSION	456	287	All SZGR 2.0 genes in this pathway
GREGORY SYNTHETIC LETHAL WITH IMATINIB	145	83	All SZGR 2.0 genes in this pathway
DUTERTRE ESTRADIOL RESPONSE 6HR UP	229	149	All SZGR 2.0 genes in this pathway
BHAT ESR1 TARGETS NOT VIA AKT1 UP	211	131	All SZGR 2.0 genes in this pathway
BHAT ESR1 TARGETS VIA AKT1 UP	281	183	All SZGR 2.0 genes in this pathway
BRUINS UVC RESPONSE VIA TP53 GROUP D	280	158	All SZGR 2.0 genes in this pathway
KASLER HDAC7 TARGETS 1 UP	194	133	All SZGR 2.0 genes in this pathway
DUAN PRDM5 TARGETS	79	52	All SZGR 2.0 genes in this pathway
PURBEY TARGETS OF CTBP1 AND SATB1 UP	87	52	All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG BOUND 8D	658	397	All SZGR 2.0 genes in this pathway
VANOEVELEN MYOGENESIS SIN3A TARGETS	220	133	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-128	739	745	1A	hsa-miR-128a	UCACAGUGAACCGGUCUCUUUU
miR-128	739	745	1A	hsa-miR-128b	UCACAGUGAACCGGUCUCUUUC
miR-135	374	380	m8	hsa-miR-135a	UAUGGCUUUUUAUUCCUAUGUGA
miR-135	374	380	m8	hsa-miR-135b	UAUGGCUUUUCAUUCCUAUGUG
miR-138	329	336	1A,m8	hsa-miR-138^brain	AGCUGGUGUUGUGAAUC
miR-138	329	336	1A,m8	hsa-miR-138^brain	AGCUGGUGUUGUGAAUC
miR-205	578	584	1A	hsa-miR-205	UCCUUCAUUCCACCGGAGUCUG
miR-218	564	570	m8	hsa-miR-218^brain	UUGUGCUUGAUCUAACCAUGU
miR-27	739	746	1A,m8	hsa-miR-27a^brain	UUCACAGUGGCUAAGUUCCGC
miR-27	739	746	1A,m8	hsa-miR-27b^brain	UUCACAGUGGCUAAGUUCUGC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: RARA