Gene Page: ZFAND3
Summary ?
| GeneID | 60685 |
| Symbol | ZFAND3 |
| Synonyms | TEX27 |
| Description | zinc finger AN1-type containing 3 |
| Reference | MIM:607455|HGNC:HGNC:18019|Ensembl:ENSG00000156639|HPRD:12121|Vega:OTTHUMG00000014629 |
| Gene type | protein-coding |
| Map location | 6p21.2 |
| Pascal p-value | 0.04 |
| Sherlock p-value | 0.436 |
| Fetal beta | 0.386 |
| DMG | 1 (# studies) |
| eGene | Myers' cis & trans |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| DMG:Wockner_2014 | Genome-wide DNA methylation analysis | This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24). | 1 |
| GSMA_I | Genome scan meta-analysis | Psr: 0.033 | |
| GSMA_IIE | Genome scan meta-analysis (European-ancestry samples) | Psr: 0.04433 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
| Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
|---|---|---|---|---|---|---|---|
| cg06021784 | 6 | 38092211 | ZFAND3 | 1.282E-4 | 0.273 | 0.03 | DMG:Wockner_2014 |
eQTL annotation
| SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
|---|---|---|---|---|---|---|---|---|
| rs924039 | chr6 | 170362119 | ZFAND3 | 60685 | 0.2 | trans |
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0003677 | DNA binding | IEA | - | |
| GO:0008270 | zinc ion binding | IEA | - | |
| GO:0046872 | metal ion binding | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| GARY CD5 TARGETS UP | 473 | 314 | All SZGR 2.0 genes in this pathway |
| OSMAN BLADDER CANCER UP | 404 | 246 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN APOPTOSIS BY DOXORUBICIN DN | 1781 | 1082 | All SZGR 2.0 genes in this pathway |
| GRAESSMANN RESPONSE TO MC AND DOXORUBICIN DN | 770 | 415 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
| FOSTER TOLERANT MACROPHAGE UP | 156 | 92 | All SZGR 2.0 genes in this pathway |
| TOOKER GEMCITABINE RESISTANCE UP | 79 | 40 | All SZGR 2.0 genes in this pathway |
| KYNG NORMAL AGING DN | 30 | 13 | All SZGR 2.0 genes in this pathway |
| KYNG WERNER SYNDROM DN | 29 | 14 | All SZGR 2.0 genes in this pathway |
| WANG RESPONSE TO GSK3 INHIBITOR SB216763 UP | 397 | 206 | All SZGR 2.0 genes in this pathway |
| LEE BMP2 TARGETS UP | 745 | 475 | All SZGR 2.0 genes in this pathway |
| PEDRIOLI MIR31 TARGETS DN | 418 | 245 | All SZGR 2.0 genes in this pathway |
| ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY | 1839 | 928 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-101 | 142 | 149 | 1A,m8 | hsa-miR-101 | UACAGUACUGUGAUAACUGAAG |
| miR-124.1 | 312 | 318 | 1A | hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA |
| miR-124/506 | 483 | 489 | m8 | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
| hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
| miR-139 | 144 | 150 | m8 | hsa-miR-139brain | UCUACAGUGCACGUGUCU |
| miR-142-5p | 2183 | 2189 | m8 | hsa-miR-142-5p | CAUAAAGUAGAAAGCACUAC |
| miR-144 | 143 | 149 | 1A | hsa-miR-144 | UACAGUAUAGAUGAUGUACUAG |
| miR-149 | 70 | 76 | 1A | hsa-miR-149brain | UCUGGCUCCGUGUCUUCACUCC |
| miR-186 | 122 | 128 | 1A | hsa-miR-186 | CAAAGAAUUCUCCUUUUGGGCUU |
| hsa-miR-186 | CAAAGAAUUCUCCUUUUGGGCUU | ||||
| miR-214 | 2200 | 2207 | 1A,m8 | hsa-miR-214brain | ACAGCAGGCACAGACAGGCAG |
| miR-27 | 2028 | 2034 | 1A | hsa-miR-27abrain | UUCACAGUGGCUAAGUUCCGC |
| hsa-miR-27bbrain | UUCACAGUGGCUAAGUUCUGC | ||||
| miR-299-5p | 2218 | 2224 | 1A | hsa-miR-299-5p | UGGUUUACCGUCCCACAUACAU |
| miR-338 | 289 | 295 | 1A | hsa-miR-338brain | UCCAGCAUCAGUGAUUUUGUUGA |
| miR-381 | 212 | 218 | 1A | hsa-miR-381 | UAUACAAGGGCAAGCUCUCUGU |
| hsa-miR-381 | UAUACAAGGGCAAGCUCUCUGU | ||||
| miR-495 | 2035 | 2042 | 1A,m8 | hsa-miR-495brain | AAACAAACAUGGUGCACUUCUUU |
| miR-542-3p | 282 | 288 | m8 | hsa-miR-542-3p | UGUGACAGAUUGAUAACUGAAA |
| miR-543 | 43 | 49 | 1A | hsa-miR-543 | AAACAUUCGCGGUGCACUUCU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.