Gene Page: MARCH7
Summary ?
| GeneID | 64844 |
| Symbol | MARCH7 |
| Synonyms | AXO|AXOT|MARCH-VII|RNF177 |
| Description | membrane associated ring-CH-type finger 7 |
| Reference | MIM:613334|HGNC:HGNC:17393|Ensembl:ENSG00000136536|HPRD:09817|Vega:OTTHUMG00000132029 |
| Gene type | protein-coding |
| Map location | 2q24.2 |
| Pascal p-value | 9.929E-4 |
| Sherlock p-value | 8.849E-6 |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| GSMA_IIA | Genome scan meta-analysis (All samples) | Psr: 0.02395 |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0016874 | ligase activity | IEA | - | |
| GO:0008270 | zinc ion binding | IEA | - | |
| GO:0046872 | metal ion binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0006511 | ubiquitin-dependent protein catabolic process | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| ONKEN UVEAL MELANOMA UP | 783 | 507 | All SZGR 2.0 genes in this pathway |
| RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED DN | 805 | 505 | All SZGR 2.0 genes in this pathway |
| ENK UV RESPONSE KERATINOCYTE DN | 485 | 334 | All SZGR 2.0 genes in this pathway |
| SCHLOSSER SERUM RESPONSE DN | 712 | 443 | All SZGR 2.0 genes in this pathway |
| DACOSTA UV RESPONSE VIA ERCC3 DN | 855 | 609 | All SZGR 2.0 genes in this pathway |
| DACOSTA UV RESPONSE VIA ERCC3 COMMON DN | 483 | 336 | All SZGR 2.0 genes in this pathway |
| MARTORIATI MDM4 TARGETS FETAL LIVER DN | 514 | 319 | All SZGR 2.0 genes in this pathway |
| PUJANA ATM PCC NETWORK | 1442 | 892 | All SZGR 2.0 genes in this pathway |
| BUYTAERT PHOTODYNAMIC THERAPY STRESS UP | 811 | 508 | All SZGR 2.0 genes in this pathway |
| BERTUCCI INVASIVE CARCINOMA DUCTAL VS LOBULAR DN | 46 | 34 | All SZGR 2.0 genes in this pathway |
| SCHAEFFER PROSTATE DEVELOPMENT 6HR DN | 514 | 330 | All SZGR 2.0 genes in this pathway |
| BENPORATH NANOG TARGETS | 988 | 594 | All SZGR 2.0 genes in this pathway |
| SHEN SMARCA2 TARGETS UP | 424 | 268 | All SZGR 2.0 genes in this pathway |
| CHESLER BRAIN HIGHEST EXPRESSION | 40 | 29 | All SZGR 2.0 genes in this pathway |
| RAMALHO STEMNESS UP | 206 | 118 | All SZGR 2.0 genes in this pathway |
| CHEN HOXA5 TARGETS 9HR UP | 223 | 132 | All SZGR 2.0 genes in this pathway |
| PECE MAMMARY STEM CELL DN | 146 | 88 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-101 | 324 | 330 | 1A | hsa-miR-101 | UACAGUACUGUGAUAACUGAAG |
| miR-124.1 | 444 | 451 | 1A,m8 | hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA |
| miR-124/506 | 444 | 450 | 1A | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
| hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
| miR-137 | 575 | 581 | 1A | hsa-miR-137 | UAUUGCUUAAGAAUACGCGUAG |
| miR-139 | 325 | 331 | m8 | hsa-miR-139brain | UCUACAGUGCACGUGUCU |
| miR-141/200a | 484 | 490 | m8 | hsa-miR-141 | UAACACUGUCUGGUAAAGAUGG |
| hsa-miR-200a | UAACACUGUCUGGUAACGAUGU | ||||
| miR-144 | 324 | 330 | 1A | hsa-miR-144 | UACAGUAUAGAUGAUGUACUAG |
| miR-155 | 530 | 536 | m8 | hsa-miR-155 | UUAAUGCUAAUCGUGAUAGGGG |
| miR-199 | 818 | 824 | m8 | hsa-miR-199a | CCCAGUGUUCAGACUACCUGUUC |
| hsa-miR-199b | CCCAGUGUUUAGACUAUCUGUUC | ||||
| miR-27 | 25 | 31 | 1A | hsa-miR-27abrain | UUCACAGUGGCUAAGUUCCGC |
| hsa-miR-27bbrain | UUCACAGUGGCUAAGUUCUGC | ||||
| miR-495 | 1179 | 1185 | m8 | hsa-miR-495brain | AAACAAACAUGGUGCACUUCUUU |
| miR-496 | 1192 | 1198 | 1A | hsa-miR-496 | AUUACAUGGCCAAUCUC |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.