SZGR2

Summary ?

GeneID	6722
Symbol	SRF
Synonyms	MCM1
Description	serum response factor
Reference	MIM:600589\|HGNC:HGNC:11291\|Ensembl:ENSG00000112658\|HPRD:02788\|Vega:OTTHUMG00000014722
Gene type	protein-coding
Map location	6p21.1
Pascal p-value	3.242E-5
Sherlock p-value	0.286
Fetal beta	0.645
DMG	1 (# studies)
eGene	Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Nishioka_2013	Genome-wide DNA methylation analysis	The authors investigated the methylation profiles of DNA in peripheral blood cells from 18 patients with first-episode schizophrenia (FESZ) and from 15 normal controls.	1
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
GSMA_IIE	Genome scan meta-analysis (European-ancestry samples)	Psr: 0.04433
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias	Click to show details

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg16041611	6	43139680	SRF		-0.087	0.51	DMG:Nishioka_2013

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	pvalue	qvalue	TSS distance	eQTL type
rs1578978	chr8	118196802	SRF	6722		0.02		trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003700	transcription factor activity	IEA		-
GO:0003702	RNA polymerase II transcription factor activity	TAS		3203386
GO:0008134	transcription factor binding	IPI		16054032
GO:0043565	sequence-specific DNA binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0001829	trophectodermal cell differentiation	IDA		17576768
GO:0001947	heart looping	IEA		-
GO:0006355	regulation of transcription, DNA-dependent	IEA		-
GO:0006350	transcription	IEA		-
GO:0007165	signal transduction	TAS		3203386
GO:0007507	heart development	IEA		-
GO:0007275	multicellular organismal development	IEA		-
GO:0045944	positive regulation of transcription from RNA polymerase II promoter	IDA		17576768
GO:0045597	positive regulation of cell differentiation	IDA		17576768
GO:0046716	muscle maintenance	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	IEA		-
GO:0005634	nucleus	TAS		3203386
GO:0005730	nucleolus	IDA		18029348
GO:0005737	cytoplasm	IDA		18029348
GO:0005783	endoplasmic reticulum	IDA		18029348

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
ASCC1	ASC1p50 \| CGI-18 \| RP11-150D20.4	activating signal cointegrator 1 complex subunit 1	Reconstituted Complex Two-hybrid	BioGRID	12077347
ASCC2	ASC1p100	activating signal cointegrator 1 complex subunit 2	Reconstituted Complex Two-hybrid	BioGRID	12077347
ASCC3	ASC1p200 \| DJ467N11.1 \| HELIC1 \| MGC26074 \| RNAH \| dJ121G13.4	activating signal cointegrator 1 complex subunit 3	Reconstituted Complex Two-hybrid	BioGRID	12077347
ATF6	ATF6A	activating transcription factor 6	-	HPRD,BioGRID	9271374
BARX2	MGC133368 \| MGC133369	BARX homeobox 2	-	HPRD	11278942
CD63	LAMP-3 \| ME491 \| MLA1 \| OMA81H \| TSPAN30	CD63 molecule	Two-hybrid	BioGRID	9271374
CEBPB	C/EBP-beta \| CRP2 \| IL6DBP \| LAP \| MGC32080 \| NF-IL6 \| TCF5	CCAAT/enhancer binding protein (C/EBP), beta	-	HPRD	11500490
CEBPB	C/EBP-beta \| CRP2 \| IL6DBP \| LAP \| MGC32080 \| NF-IL6 \| TCF5	CCAAT/enhancer binding protein (C/EBP), beta	Affinity Capture-Western Reconstituted Complex Two-hybrid	BioGRID	9032301 \|10318842
CREBBP	CBP \| KAT3A \| RSTS	CREB binding protein	Affinity Capture-Western	BioGRID	12622724
CRIP2	CRIP \| CRP2 \| ESP1	cysteine-rich protein 2	-	HPRD	12530967
ELK1	-	ELK1, member of ETS oncogene family	-	HPRD,BioGRID	9010223
ELK4	SAP1	ELK4, ETS-domain protein (SRF accessory protein 1)	-	HPRD	11406578 \|11846562
ELK4	SAP1	ELK4, ETS-domain protein (SRF accessory protein 1)	-	HPRD,BioGRID	11406578
FHL1	FHL1B \| FLH1A \| KYO-T \| MGC111107 \| SLIM1 \| XMPMA \| bA535K18.1	four and a half LIM domains 1	SRF interacts with FHL1. This interaction was modeled on a demonstrated interaction between human SRF and FHL1 from an unspecified species.	BIND	15610731
FHL2	AAG11 \| DRAL \| SLIM3	four and a half LIM domains 2	SRF interacts with FHL2.	BIND	15610731
FHL3	MGC19547 \| MGC23614 \| MGC8696 \| SLIM2	four and a half LIM domains 3	SRF interacts with FHL3. This interaction was modeled on a demonstrated interaction between human SRF and FHL3 from an unspecified species.	BIND	15610731
FHL5	ACT \| FLJ33049 \| KIAA0776 \| RP3-393D12.2 \| dJ393D12.2	four and a half LIM domains 5	SRF interacts with ACT. This interaction was modeled on a demonstrated interaction between human SRF and ACT from an unspecified species.	BIND	15610731
FLI1	EWSR2 \| SIC-1	Friend leukemia virus integration 1	-	HPRD,BioGRID	9010223 \|10606656
FOS	AP-1 \| C-FOS	v-fos FBJ murine osteosarcoma viral oncogene homolog	SRF interacts with the c-fos promoter CArG box. This interaction was modeled on a demonstrated interaction between human SRF and c-fos promoter CArG box from an unspecified species.	BIND	15610731
FOSL1	FRA \| FRA1 \| fra-1	FOS-like antigen 1	SRF interacts with the region of the FRA-1 promoter containing the SRE and ATF sites.	BIND	15806162
GATA4	MGC126629	GATA binding protein 4	-	HPRD,BioGRID	11158291
GTF2F1	BTF4 \| RAP74 \| TF2F1 \| TFIIF	general transcription factor IIF, polypeptide 1, 74kDa	-	HPRD,BioGRID	7854423 \|8106390
GTF2I	BAP-135 \| BAP135 \| BTKAP1 \| DIWS \| FLJ38776 \| FLJ56355 \| IB291 \| SPIN \| TFII-I \| WBS \| WBSCR6	general transcription factor II, i	-	HPRD,BioGRID	9334314
HOPX	Cameo \| HOP \| LAGY \| MGC20820 \| NECC1 \| OB1 \| SMAP31 \| Toto	HOP homeobox	-	HPRD	12297045
MKL1	BSAC \| MAL \| MRTF-A	megakaryoblastic leukemia (translocation) 1	-	HPRD,BioGRID	12397177\|14565952
MKL1	BSAC \| MAL \| MRTF-A	megakaryoblastic leukemia (translocation) 1	-	HPRD	14565952
MKL2	DKFZp686J1745 \| FLJ31823 \| FLJ45623 \| MRTF-B \| NPD001	MKL/myocardin-like 2	-	HPRD,BioGRID	12397177 \|14565952
MYOCD	MYCD	myocardin	-	HPRD,BioGRID	11439182 \|12397177 \|15014501
MYOD1	MYF3 \| MYOD \| PUM \| bHLHc1	myogenic differentiation 1	-	HPRD	8617811
MYOG	MYF4 \| MYOGENIN \| bHLHc3	myogenin (myogenic factor 4)	-	HPRD,BioGRID	8617811
NCOA1	F-SRC-1 \| KAT13A \| MGC129719 \| MGC129720 \| NCoA-1 \| RIP160 \| SRC-1 \| SRC1 \| bHLHe42	nuclear receptor coactivator 1	-	HPRD	9786846
NCOA6	AIB3 \| ANTP \| ASC2 \| HOX1.1 \| HOXA7 \| KIAA0181 \| NRC \| PRIP \| RAP250 \| TRBP	nuclear receptor coactivator 6	Reconstituted Complex	BioGRID	10847592
NCOR2	CTG26 \| SMRT \| SMRTE \| SMRTE-tau \| TNRC14 \| TRAC-1 \| TRAC1	nuclear receptor co-repressor 2	-	HPRD,BioGRID	10777532
NFYA	CBF-A \| CBF-B \| FLJ11236 \| HAP2 \| NF-YA	nuclear transcription factor Y, alpha	NF-YA interacts with SRF. This interaction was modeled on a demonstrated interaction between NF-YA from an unspecified species and SRF from human.	BIND	10571058
NFYA	CBF-A \| CBF-B \| FLJ11236 \| HAP2 \| NF-YA	nuclear transcription factor Y, alpha	Reconstituted Complex Two-hybrid	BioGRID	10571058
NKX2-3	CSX3 \| NK2.3 \| NKX2.3 \| NKX2C \| NKX4-3	NK2 transcription factor related, locus 3 (Drosophila)	-	HPRD	11457859
NKX2-5	CHNG5 \| CSX \| CSX1 \| NKX2.5 \| NKX2E \| NKX4-1	NK2 transcription factor related, locus 5 (Drosophila)	-	HPRD	8887666
NKX3-1	BAPX2 \| NKX3 \| NKX3.1 \| NKX3A	NK3 homeobox 1	-	HPRD,BioGRID	10993896
PML	MYL \| PP8675 \| RNF71 \| TRIM19	promyelocytic leukemia	-	HPRD,BioGRID	12622724
PRRX1	PHOX1 \| PMX1 \| PRX1	paired related homeobox 1	-	HPRD	9334314
PYCARD	ASC \| CARD5 \| MGC10332 \| TMS \| TMS-1 \| TMS1	PYD and CARD domain containing	-	HPRD	10847592
RARG	NR1B3 \| RARC	retinoic acid receptor, gamma	Reconstituted Complex	BioGRID	11641790
REL	C-Rel	v-rel reticuloendotheliosis viral oncogene homolog (avian)	Reconstituted Complex	BioGRID	8670842
RELA	MGC131774 \| NFKB3 \| p65	v-rel reticuloendotheliosis viral oncogene homolog A (avian)	Reconstituted Complex	BioGRID	8670842
RXRA	FLJ00280 \| FLJ00318 \| FLJ16020 \| FLJ16733 \| MGC102720 \| NR2B1	retinoid X receptor, alpha	-	HPRD	11641790
RXRG	NR2B3 \| RXRC	retinoid X receptor, gamma	-	HPRD,BioGRID	11641790
SP1	-	Sp1 transcription factor	Reconstituted Complex	BioGRID	10082523
SRC	ASV \| SRC1 \| c-SRC \| p60-Src	v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian)	-	HPRD,BioGRID	9786846
SRF	MCM1	serum response factor (c-fos serum response element-binding transcription factor)	-	HPRD	11406578
SSRP1	FACT \| FACT80 \| T160	structure specific recognition protein 1	-	HPRD,BioGRID	10336466
TEAD1	AA \| REF1 \| TCF13 \| TEF-1	TEA domain family member 1 (SV40 transcriptional enhancer factor)	-	HPRD,BioGRID	11136726 \|12061776

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG MAPK SIGNALING PATHWAY	267	205	All SZGR 2.0 genes in this pathway
BIOCARTA EGF PATHWAY	31	25	All SZGR 2.0 genes in this pathway
BIOCARTA GH PATHWAY	28	22	All SZGR 2.0 genes in this pathway
BIOCARTA IGF1 PATHWAY	21	16	All SZGR 2.0 genes in this pathway
BIOCARTA IL6 PATHWAY	22	16	All SZGR 2.0 genes in this pathway
BIOCARTA INSULIN PATHWAY	22	16	All SZGR 2.0 genes in this pathway
BIOCARTA PDGF PATHWAY	32	25	All SZGR 2.0 genes in this pathway
BIOCARTA MAL PATHWAY	19	17	All SZGR 2.0 genes in this pathway
ST P38 MAPK PATHWAY	37	28	All SZGR 2.0 genes in this pathway
ST GA13 PATHWAY	37	32	All SZGR 2.0 genes in this pathway
PID RHOA PATHWAY	45	33	All SZGR 2.0 genes in this pathway
PID HDAC CLASSII PATHWAY	34	27	All SZGR 2.0 genes in this pathway
PID AR PATHWAY	61	46	All SZGR 2.0 genes in this pathway
PID ERBB1 DOWNSTREAM PATHWAY	105	78	All SZGR 2.0 genes in this pathway
PID PDGFRB PATHWAY	129	103	All SZGR 2.0 genes in this pathway
PID P38 MK2 PATHWAY	21	19	All SZGR 2.0 genes in this pathway
PID PDGFRA PATHWAY	22	18	All SZGR 2.0 genes in this pathway
PID MAPK TRK PATHWAY	34	31	All SZGR 2.0 genes in this pathway
LIU SOX4 TARGETS DN	309	191	All SZGR 2.0 genes in this pathway
MULLIGHAN MLL SIGNATURE 1 UP	380	236	All SZGR 2.0 genes in this pathway
NAGASHIMA NRG1 SIGNALING UP	176	123	All SZGR 2.0 genes in this pathway
KIM WT1 TARGETS UP	214	155	All SZGR 2.0 genes in this pathway
ENK UV RESPONSE KERATINOCYTE DN	485	334	All SZGR 2.0 genes in this pathway
YEMELYANOV GR TARGETS DN	10	8	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN UP	1142	669	All SZGR 2.0 genes in this pathway
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN UP	612	367	All SZGR 2.0 genes in this pathway
DARWICHE SKIN TUMOR PROMOTER DN	185	115	All SZGR 2.0 genes in this pathway
DARWICHE PAPILLOMA RISK LOW DN	165	107	All SZGR 2.0 genes in this pathway
DARWICHE PAPILLOMA RISK HIGH DN	180	110	All SZGR 2.0 genes in this pathway
DARWICHE SQUAMOUS CELL CARCINOMA DN	181	107	All SZGR 2.0 genes in this pathway
MARTIN INTERACT WITH HDAC	44	31	All SZGR 2.0 genes in this pathway
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN UP	479	299	All SZGR 2.0 genes in this pathway
NUYTTEN EZH2 TARGETS DN	1024	594	All SZGR 2.0 genes in this pathway
BUYTAERT PHOTODYNAMIC THERAPY STRESS DN	637	377	All SZGR 2.0 genes in this pathway
BENPORATH CYCLING GENES	648	385	All SZGR 2.0 genes in this pathway
BENPORATH ES CORE NINE CORRELATED	100	68	All SZGR 2.0 genes in this pathway
COLLIS PRKDC SUBSTRATES	20	15	All SZGR 2.0 genes in this pathway
MAGRANGEAS MULTIPLE MYELOMA IGG VS IGA UP	22	12	All SZGR 2.0 genes in this pathway
FLECHNER PBL KIDNEY TRANSPLANT REJECTED VS OK UP	63	48	All SZGR 2.0 genes in this pathway
IVANOVA HEMATOPOIESIS EARLY PROGENITOR	532	309	All SZGR 2.0 genes in this pathway
WEIGEL OXIDATIVE STRESS BY TBH AND H2O2	36	24	All SZGR 2.0 genes in this pathway
GENTILE UV RESPONSE CLUSTER D5	39	26	All SZGR 2.0 genes in this pathway
ZHU CMV ALL UP	120	89	All SZGR 2.0 genes in this pathway
GENTILE UV HIGH DOSE DN	312	203	All SZGR 2.0 genes in this pathway
ZHU CMV 24 HR UP	93	65	All SZGR 2.0 genes in this pathway
DOUGLAS BMI1 TARGETS UP	566	371	All SZGR 2.0 genes in this pathway
OUYANG PROSTATE CANCER PROGRESSION DN	21	16	All SZGR 2.0 genes in this pathway
ACEVEDO NORMAL TISSUE ADJACENT TO LIVER TUMOR DN	354	216	All SZGR 2.0 genes in this pathway
ACEVEDO LIVER CANCER DN	540	340	All SZGR 2.0 genes in this pathway
ACEVEDO METHYLATED IN LIVER CANCER DN	940	425	All SZGR 2.0 genes in this pathway
QI PLASMACYTOMA UP	259	185	All SZGR 2.0 genes in this pathway
PARK APL PATHOGENESIS DN	50	35	All SZGR 2.0 genes in this pathway
HOFFMANN LARGE TO SMALL PRE BII LYMPHOCYTE DN	72	47	All SZGR 2.0 genes in this pathway
SHEDDEN LUNG CANCER GOOD SURVIVAL A12	317	177	All SZGR 2.0 genes in this pathway
WHITFIELD CELL CYCLE G2 M	216	124	All SZGR 2.0 genes in this pathway
ZWANG CLASS 1 TRANSIENTLY INDUCED BY EGF	516	308	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-101	1315	1321	1A	hsa-miR-101	UACAGUACUGUGAUAACUGAAG
miR-122	145	151	1A	hsa-miR-122a	UGGAGUGUGACAAUGGUGUUUGU
miR-125/351	470	476	m8	hsa-miR-125b^brain	UCCCUGAGACCCUAACUUGUGA
miR-125/351	470	476	m8	hsa-miR-125a^brain	UCCCUGAGACCCUUUAACCUGUG
miR-142-5p	1360	1366	m8	hsa-miR-142-5p	CAUAAAGUAGAAAGCACUAC
miR-144	1315	1321	1A	hsa-miR-144	UACAGUAUAGAUGAUGUACUAG
miR-150	2036	2042	m8	hsa-miR-150	UCUCCCAACCCUUGUACCAGUG
miR-186	69	75	1A	hsa-miR-186	CAAAGAAUUCUCCUUUUGGGCUU
miR-200bc/429	1384	1390	m8	hsa-miR-200b	UAAUACUGCCUGGUAAUGAUGAC
				hsa-miR-200c	UAAUACUGCCGGGUAAUGAUGG
				hsa-miR-429	UAAUACUGUCUGGUAAAACCGU
				hsa-miR-200b	UAAUACUGCCUGGUAAUGAUGAC
				hsa-miR-200c	UAAUACUGCCGGGUAAUGAUGG
				hsa-miR-429	UAAUACUGUCUGGUAAAACCGU
miR-22	1310	1316	1A	hsa-miR-22^brain	AAGCUGCCAGUUGAAGAACUGU
miR-28	531	537	m8	hsa-miR-28^brain	AAGGAGCUCACAGUCUAUUGAG
miR-377	2021	2027	m8	hsa-miR-377	AUCACACAAAGGCAACUUUUGU
miR-485-5p	398	404	m8	hsa-miR-485-5p	AGAGGCUGGCCGUGAUGAAUUC
miR-486	1401	1407	m8	hsa-miR-486	UCCUGUACUGAGCUGCCCCGAG
miR-7	659	665	m8	hsa-miR-7^SZ	UGGAAGACUAGUGAUUUUGUUG
miR-9	153	159	1A	hsa-miR-9^SZ	UCUUUGGUUAUCUAGCUGUAUGA

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: SRF