SZGR2

Summary ?

GeneID	688
Symbol	KLF5
Synonyms	BTEB2\|CKLF\|IKLF
Description	Kruppel-like factor 5 (intestinal)
Reference	MIM:602903\|HGNC:HGNC:6349\|Ensembl:ENSG00000102554\|HPRD:04212\|Vega:OTTHUMG00000017074
Gene type	protein-coding
Map location	13q22.1
Pascal p-value	0.002
Fetal beta	-0.376
eGene	Cerebellar Hemisphere Myers' cis & trans

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Association	A combined odds ratio method (Sun et al. 2008), association studies	1	Link to SZGene
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details

Section I. Genetics and epigenetics annotation

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	qvalue	eQTL type
rs17131759	chr1	86495557	KLF5	688	0.04	trans
rs17131472	chr1	91962966	KLF5	688	0.07	trans
rs6710894	chr2	66876700	KLF5	688	0.04	trans
rs17046675	chr2	117922028	KLF5	688	0.16	trans
rs1691463	chr3	84914366	KLF5	688	0.17	trans
rs2922180	chr3	125280472	KLF5	688	0.05	trans
rs2976809	chr3	125451738	KLF5	688	0.04	trans
rs16889842	chr4	9872012	KLF5	688	0.01	trans
snp_a-1976228		0	KLF5	688	0.19	trans
rs313946	chr4	113975904	KLF5	688	0.03	trans
rs10050805	chr5	30805352	KLF5	688	0.09	trans
rs837115	chr5	40736290	KLF5	688	0.18	trans
rs17056435	chr5	158453782	KLF5	688	0.08	trans
rs6920042	chr6	67907570	KLF5	688	0.04	trans
rs6939897	chr6	67913123	KLF5	688	0.12	trans
rs6455226	chr6	67930295	KLF5	688	3.17E-4	trans
rs9451867	chr6	92659609	KLF5	688	0.07	trans
rs2398707	chr7	2113428	KLF5	688	0.02	trans
rs3778948	chr7	2123290	KLF5	688	0.1	trans
rs3778951	chr7	2125319	KLF5	688	0.02	trans
rs3778957	chr7	2127710	KLF5	688	0.02	trans
rs3778958	chr7	2127794	KLF5	688	0.1	trans
rs3778968	chr7	2139903	KLF5	688	0.1	trans
rs3823550	chr7	137346101	KLF5	688	0.09	trans
rs7823144	chr8	38028194	KLF5	688	0.16	trans
rs11783167	chr8	129102799	KLF5	688	0.18	trans
rs2253777	chr9	93467893	KLF5	688	0.03	trans
rs998410	chr9	117622673	KLF5	688	0.03	trans
rs10747972		0	KLF5	688	0.14	trans
rs11112163	chr12	105072508	KLF5	688	0.01	trans
rs1498763	chr12	115975789	KLF5	688	0.19	trans
rs4882759	chr12	128909713	KLF5	688	0.2	trans
rs9551590	chr13	29589464	KLF5	688	0.03	trans
rs10142086	chr14	35135892	KLF5	688	0.03	trans
rs1951867	chr14	54407191	KLF5	688	0.17	trans
rs2093759	chr14	97171024	KLF5	688	0.19	trans
rs17244419	chr14	97171074	KLF5	688	0.02	trans
rs7177212	chr15	34425413	KLF5	688	0.1	trans
rs17841422	chr17	20969134	KLF5	688	0.19	trans
rs11873703	chr18	61448702	KLF5	688	0.01	trans
rs6017989	chr20	45329846	KLF5	688	0.2	trans
rs6095741	chr20	48666589	KLF5	688	0.01	trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003700	transcription factor activity	IEA		-
GO:0003702	RNA polymerase II transcription factor activity	TAS		8479902
GO:0005515	protein binding	IEA		-
GO:0008270	zinc ion binding	IEA		-
GO:0046872	metal ion binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0001525	angiogenesis	IEA		-
GO:0006355	regulation of transcription, DNA-dependent	IEA		-
GO:0006366	transcription from RNA polymerase II promoter	TAS		8479902
GO:0030033	microvillus biogenesis	IEA		-
GO:0045941	positive regulation of transcription	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005622	intracellular	IEA		-
GO:0005634	nucleus	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
CREBBP	CBP \| KAT3A \| RSTS	CREB binding protein	-	HPRD,BioGRID	12682370
EP300	KAT3B \| p300	E1A binding protein p300	Affinity Capture-Western	BioGRID	14612398
GTF2B	TF2B \| TFIIB	general transcription factor IIB	Reconstituted Complex	BioGRID	9089417
GTF2E2	FE \| TF2E2 \| TFIIE-B	general transcription factor IIE, polypeptide 2, beta 34kDa	-	HPRD	9089417
GTF2F1	BTF4 \| RAP74 \| TF2F1 \| TFIIF	general transcription factor IIF, polypeptide 1, 74kDa	Reconstituted Complex	BioGRID	9089417
GTF2F2	BTF4 \| RAP30 \| TF2F2 \| TFIIF	general transcription factor IIF, polypeptide 2, 30kDa	-	HPRD	9089417
NFKB1	DKFZp686C01211 \| EBP-1 \| KBF1 \| MGC54151 \| NF-kappa-B \| NFKB-p105 \| NFKB-p50 \| p105	nuclear factor of kappa light polypeptide gene enhancer in B-cells 1	-	HPRD,BioGRID	14573617
PRKCA	AAG6 \| MGC129900 \| MGC129901 \| PKC-alpha \| PKCA \| PRKACA	protein kinase C, alpha	Biochemical Activity	BioGRID	12682370
RARA	NR1B1 \| RAR	retinoic acid receptor, alpha	in vitro in vivo	BioGRID	12101409
SET	2PP2A \| I2PP2A \| IGAAD \| IPP2A2 \| PHAPII \| TAF-I \| TAF-IBETA	SET nuclear oncogene	Affinity Capture-MS Affinity Capture-Western Reconstituted Complex	BioGRID	14612398
TBP	GTF2D \| GTF2D1 \| MGC117320 \| MGC126054 \| MGC126055 \| SCA17 \| TFIID	TATA box binding protein	Reconstituted Complex	BioGRID	9089417

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
REACTOME DEVELOPMENTAL BIOLOGY	396	292	All SZGR 2.0 genes in this pathway
REACTOME TRANSCRIPTIONAL REGULATION OF WHITE ADIPOCYTE DIFFERENTIATION	72	53	All SZGR 2.0 genes in this pathway
NAKAMURA TUMOR ZONE PERIPHERAL VS CENTRAL DN	634	384	All SZGR 2.0 genes in this pathway
ONKEN UVEAL MELANOMA DN	526	357	All SZGR 2.0 genes in this pathway
SENGUPTA NASOPHARYNGEAL CARCINOMA WITH LMP1 UP	408	247	All SZGR 2.0 genes in this pathway
WILCOX RESPONSE TO PROGESTERONE UP	152	90	All SZGR 2.0 genes in this pathway
FULCHER INFLAMMATORY RESPONSE LECTIN VS LPS DN	463	290	All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE LIVE UP	485	293	All SZGR 2.0 genes in this pathway
LIU TARGETS OF VMYB VS CMYB DN	43	30	All SZGR 2.0 genes in this pathway
CHARAFE BREAST CANCER LUMINAL VS BASAL DN	455	304	All SZGR 2.0 genes in this pathway
ROY WOUND BLOOD VESSEL DN	22	14	All SZGR 2.0 genes in this pathway
VECCHI GASTRIC CANCER EARLY UP	430	232	All SZGR 2.0 genes in this pathway
JAEGER METASTASIS DN	258	141	All SZGR 2.0 genes in this pathway
GARGALOVIC RESPONSE TO OXIDIZED PHOSPHOLIPIDS BLUE UP	136	80	All SZGR 2.0 genes in this pathway
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 6HR UP	85	54	All SZGR 2.0 genes in this pathway
TAKEDA TARGETS OF NUP98 HOXA9 FUSION 3D UP	182	110	All SZGR 2.0 genes in this pathway
TIEN INTESTINE PROBIOTICS 2HR UP	27	19	All SZGR 2.0 genes in this pathway
TIEN INTESTINE PROBIOTICS 6HR UP	55	34	All SZGR 2.0 genes in this pathway
TIEN INTESTINE PROBIOTICS 24HR DN	214	133	All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE FIMA UP	544	308	All SZGR 2.0 genes in this pathway
ZHOU INFLAMMATORY RESPONSE LPS UP	431	237	All SZGR 2.0 genes in this pathway
WAMUNYOKOLI OVARIAN CANCER LMP UP	265	158	All SZGR 2.0 genes in this pathway
WAMUNYOKOLI OVARIAN CANCER GRADES 1 2 UP	137	84	All SZGR 2.0 genes in this pathway
DODD NASOPHARYNGEAL CARCINOMA UP	1821	933	All SZGR 2.0 genes in this pathway
LIU CDX2 TARGETS UP	36	22	All SZGR 2.0 genes in this pathway
ENK UV RESPONSE KERATINOCYTE UP	530	342	All SZGR 2.0 genes in this pathway
BERENJENO ROCK SIGNALING NOT VIA RHOA DN	48	34	All SZGR 2.0 genes in this pathway
VANHARANTA UTERINE FIBROID DN	67	45	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN UP	1142	669	All SZGR 2.0 genes in this pathway
BARIS THYROID CANCER DN	59	45	All SZGR 2.0 genes in this pathway
WANG BARRETTS ESOPHAGUS DN	25	13	All SZGR 2.0 genes in this pathway
MCBRYAN PUBERTAL TGFB1 TARGETS DN	62	44	All SZGR 2.0 genes in this pathway
RIZ ERYTHROID DIFFERENTIATION HEMGN	31	21	All SZGR 2.0 genes in this pathway
RASHI RESPONSE TO IONIZING RADIATION 2	127	92	All SZGR 2.0 genes in this pathway
FARMER BREAST CANCER APOCRINE VS BASAL	330	217	All SZGR 2.0 genes in this pathway
FARMER BREAST CANCER BASAL VS LULMINAL	330	215	All SZGR 2.0 genes in this pathway
GRUETZMANN PANCREATIC CANCER UP	358	245	All SZGR 2.0 genes in this pathway
KIM MYC AMPLIFICATION TARGETS DN	97	51	All SZGR 2.0 genes in this pathway
KIM MYCN AMPLIFICATION TARGETS DN	103	59	All SZGR 2.0 genes in this pathway
NUYTTEN NIPP1 TARGETS DN	848	527	All SZGR 2.0 genes in this pathway
BUYTAERT PHOTODYNAMIC THERAPY STRESS UP	811	508	All SZGR 2.0 genes in this pathway
WU CELL MIGRATION	184	114	All SZGR 2.0 genes in this pathway
BENPORATH NANOG TARGETS	988	594	All SZGR 2.0 genes in this pathway
BENPORATH OCT4 TARGETS	290	172	All SZGR 2.0 genes in this pathway
BENPORATH SOX2 TARGETS	734	436	All SZGR 2.0 genes in this pathway
BENPORATH NOS TARGETS	179	105	All SZGR 2.0 genes in this pathway
BENPORATH ES CORE NINE CORRELATED	100	68	All SZGR 2.0 genes in this pathway
AMIT SERUM RESPONSE 120 MCF10A	65	44	All SZGR 2.0 genes in this pathway
ONDER CDH1 TARGETS 2 DN	464	276	All SZGR 2.0 genes in this pathway
SMITH TERT TARGETS UP	145	91	All SZGR 2.0 genes in this pathway
HALMOS CEBPA TARGETS UP	52	34	All SZGR 2.0 genes in this pathway
NGUYEN NOTCH1 TARGETS DN	86	67	All SZGR 2.0 genes in this pathway
CROMER METASTASIS DN	81	58	All SZGR 2.0 genes in this pathway
TAVOR CEBPA TARGETS UP	48	36	All SZGR 2.0 genes in this pathway
TRAYNOR RETT SYNDROM DN	19	14	All SZGR 2.0 genes in this pathway
WANG CISPLATIN RESPONSE AND XPC DN	228	146	All SZGR 2.0 genes in this pathway
BLALOCK ALZHEIMERS DISEASE UP	1691	1088	All SZGR 2.0 genes in this pathway
DELASERNA MYOD TARGETS UP	89	51	All SZGR 2.0 genes in this pathway
BURTON ADIPOGENESIS 3	101	64	All SZGR 2.0 genes in this pathway
TAKAO RESPONSE TO UVB RADIATION DN	98	67	All SZGR 2.0 genes in this pathway
MCCLUNG COCAIN REWARD 4WK	75	47	All SZGR 2.0 genes in this pathway
CUI TCF21 TARGETS 2 UP	428	266	All SZGR 2.0 genes in this pathway
BURTON ADIPOGENESIS PEAK AT 8HR	39	31	All SZGR 2.0 genes in this pathway
BILD HRAS ONCOGENIC SIGNATURE	261	166	All SZGR 2.0 genes in this pathway
OSADA ASCL1 TARGETS DN	24	20	All SZGR 2.0 genes in this pathway
MCCABE BOUND BY HOXC6	469	239	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER RELAPSE IN BONE DN	315	197	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER LUMINAL B DN	564	326	All SZGR 2.0 genes in this pathway
SMID BREAST CANCER BASAL UP	648	398	All SZGR 2.0 genes in this pathway
WEST ADRENOCORTICAL TUMOR DN	546	362	All SZGR 2.0 genes in this pathway
CHEN HOXA5 TARGETS 9HR UP	223	132	All SZGR 2.0 genes in this pathway
CONRAD STEM CELL	39	27	All SZGR 2.0 genes in this pathway
LEE LIVER CANCER SURVIVAL DN	175	103	All SZGR 2.0 genes in this pathway
LINDSTEDT DENDRITIC CELL MATURATION B	53	36	All SZGR 2.0 genes in this pathway
SWEET LUNG CANCER KRAS UP	491	316	All SZGR 2.0 genes in this pathway
MELLMAN TUT1 TARGETS DN	47	29	All SZGR 2.0 genes in this pathway
HAN SATB1 TARGETS DN	442	275	All SZGR 2.0 genes in this pathway
HOSHIDA LIVER CANCER SUBCLASS S1	237	159	All SZGR 2.0 genes in this pathway
DUTERTRE ESTRADIOL RESPONSE 24HR DN	505	328	All SZGR 2.0 genes in this pathway
GABRIELY MIR21 TARGETS	289	187	All SZGR 2.0 genes in this pathway
CHYLA CBFA2T3 TARGETS DN	242	146	All SZGR 2.0 genes in this pathway
DELPUECH FOXO3 TARGETS UP	68	49	All SZGR 2.0 genes in this pathway
LEE BMP2 TARGETS DN	882	538	All SZGR 2.0 genes in this pathway
PEDRIOLI MIR31 TARGETS DN	418	245	All SZGR 2.0 genes in this pathway
ACEVEDO FGFR1 TARGETS IN PROSTATE CANCER MODEL UP	289	184	All SZGR 2.0 genes in this pathway
SMIRNOV RESPONSE TO IR 2HR UP	53	33	All SZGR 2.0 genes in this pathway
ZWANG CLASS 2 TRANSIENTLY INDUCED BY EGF	51	29	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-142-5p	534	540	1A	hsa-miR-142-5p	CAUAAAGUAGAAAGCACUAC
miR-145	78	85	1A,m8	hsa-miR-145	GUCCAGUUUUCCCAGGAAUCCCUU
miR-153	1507	1514	1A,m8	hsa-miR-153	UUGCAUAGUCACAAAAGUGA
				hsa-miR-153	UUGCAUAGUCACAAAAGUGA
				hsa-miR-153	UUGCAUAGUCACAAAAGUGA
miR-182	1206	1212	1A	hsa-miR-182	UUUGGCAAUGGUAGAACUCACA
miR-23	1158	1164	m8	hsa-miR-23a^brain	AUCACAUUGCCAGGGAUUUCC
miR-23	1158	1164	m8	hsa-miR-23b^brain	AUCACAUUGCCAGGGAUUACC
miR-320	531	538	1A,m8	hsa-miR-320	AAAAGCUGGGUUGAGAGGGCGAA
miR-323	1157	1164	1A,m8	hsa-miR-323^brain	GCACAUUACACGGUCGACCUCU
miR-339	111	117	1A	hsa-miR-339	UCCCUGUCCUCCAGGAGCUCA
miR-375	448	454	1A	hsa-miR-375	UUUGUUCGUUCGGCUCGCGUGA
miR-410	1568	1574	1A	hsa-miR-410	AAUAUAACACAGAUGGCCUGU
miR-448	521	528	1A,m8	hsa-miR-448	UUGCAUAUGUAGGAUGUCCCAU
				hsa-miR-448	UUGCAUAUGUAGGAUGUCCCAU
				hsa-miR-448	UUGCAUAUGUAGGAUGUCCCAU
miR-495	1338	1345	1A,m8	hsa-miR-495^brain	AAACAAACAUGGUGCACUUCUUU
miR-505	1108	1114	1A	hsa-miR-505	GUCAACACUUGCUGGUUUCCUC
miR-9	1179	1185	m8	hsa-miR-9^SZ	UCUUUGGUUAUCUAGCUGUAUGA
miR-9	1179	1185	m8	hsa-miR-9^SZ	UCUUUGGUUAUCUAGCUGUAUGA
miR-96	1206	1212	1A	hsa-miR-96^brain	UUUGGCACUAGCACAUUUUUGC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: KLF5