Gene Page: NKX2-1
Summary ?
GeneID | 7080 |
Symbol | NKX2-1 |
Synonyms | BCH|BHC|NK-2|NKX2.1|NKX2A|NMTC1|T/EBP|TEBP|TITF1|TTF-1|TTF1 |
Description | NK2 homeobox 1 |
Reference | MIM:600635|HGNC:HGNC:11825|Ensembl:ENSG00000136352|HPRD:02798|Vega:OTTHUMG00000140225 |
Gene type | protein-coding |
Map location | 14q13 |
Pascal p-value | 0.448 |
Fetal beta | -0.074 |
eGene | Anterior cingulate cortex BA24 |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 3 |
Section I. Genetics and epigenetics annotation
eQTL annotation
SNP ID | Chromosome | Position | eGene | Gene Entrez ID | pvalue | qvalue | TSS distance | eQTL type |
---|---|---|---|---|---|---|---|---|
rs1951169 | 14 | 36965881 | NKX2-1 | ENSG00000136352.13 | 2.92827E-6 | 0.04 | 24473 | gtex_brain_ba24 |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
Top 10 positively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
FAM176B | 0.77 | 0.66 |
VAMP5 | 0.70 | 0.56 |
IFI27 | 0.70 | 0.50 |
METRN | 0.70 | 0.49 |
IL32 | 0.69 | 0.64 |
GSDMD | 0.68 | 0.56 |
CLDN5 | 0.68 | 0.68 |
GNG11 | 0.67 | 0.54 |
CRIP1 | 0.67 | 0.51 |
IGFBP7 | 0.64 | 0.63 |
Top 10 negatively co-expressed genes | ||
Gene | Pearson's Correlation | Spearman's Correlation |
WAC | -0.61 | -0.61 |
EZH1 | -0.60 | -0.60 |
SLC4A1AP | -0.58 | -0.51 |
ZNF331 | -0.58 | -0.59 |
MTMR15 | -0.58 | -0.56 |
PTK2 | -0.57 | -0.53 |
HBS1L | -0.57 | -0.58 |
PIAS2 | -0.56 | -0.54 |
DDHD1 | -0.56 | -0.52 |
FBXW11 | -0.56 | -0.50 |
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0003700 | transcription factor activity | IEA | - | |
GO:0005515 | protein binding | ISS | - | |
GO:0016563 | transcription activator activity | ISS | - | |
GO:0016563 | transcription activator activity | NAS | 7711080 |7713914 | |
GO:0043565 | sequence-specific DNA binding | IEA | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007420 | brain development | IEA | Brain (GO term level: 7) | - |
GO:0001764 | neuron migration | IEA | neuron (GO term level: 8) | - |
GO:0021798 | forebrain dorsal/ventral pattern formation | IEA | Brain (GO term level: 10) | - |
GO:0009887 | organ morphogenesis | IEA | - | |
GO:0007492 | endoderm development | IEA | - | |
GO:0007389 | pattern specification process | IEA | - | |
GO:0030878 | thyroid gland development | IEA | - | |
GO:0030324 | lung development | IEA | - | |
GO:0045944 | positive regulation of transcription from RNA polymerase II promoter | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005634 | nucleus | NAS | - | |
GO:0005654 | nucleoplasm | ISS | - | |
GO:0005667 | transcription factor complex | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
PID HNF3B PATHWAY | 45 | 37 | All SZGR 2.0 genes in this pathway |
LUI THYROID CANCER PAX8 PPARG UP | 44 | 29 | All SZGR 2.0 genes in this pathway |
TANAKA METHYLATED IN ESOPHAGEAL CARCINOMA | 103 | 58 | All SZGR 2.0 genes in this pathway |
LUI THYROID CANCER CLUSTER 1 | 51 | 33 | All SZGR 2.0 genes in this pathway |
KIM MYC AMPLIFICATION TARGETS DN | 97 | 51 | All SZGR 2.0 genes in this pathway |
KIM MYCN AMPLIFICATION TARGETS DN | 103 | 59 | All SZGR 2.0 genes in this pathway |
LOCKWOOD AMPLIFIED IN LUNG CANCER | 214 | 139 | All SZGR 2.0 genes in this pathway |
BENPORATH SUZ12 TARGETS | 1038 | 678 | All SZGR 2.0 genes in this pathway |
BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
BENPORATH PRC2 TARGETS | 652 | 441 | All SZGR 2.0 genes in this pathway |
HALMOS CEBPA TARGETS DN | 46 | 26 | All SZGR 2.0 genes in this pathway |
DAZARD RESPONSE TO UV NHEK UP | 244 | 151 | All SZGR 2.0 genes in this pathway |
WELCSH BRCA1 TARGETS UP | 198 | 132 | All SZGR 2.0 genes in this pathway |
NIELSEN SCHWANNOMA UP | 18 | 16 | All SZGR 2.0 genes in this pathway |
LOPES METHYLATED IN COLON CANCER UP | 27 | 20 | All SZGR 2.0 genes in this pathway |
MCCABE BOUND BY HOXC6 | 469 | 239 | All SZGR 2.0 genes in this pathway |
MCCABE HOXC6 TARGETS CANCER UP | 31 | 23 | All SZGR 2.0 genes in this pathway |
MITSIADES RESPONSE TO APLIDIN UP | 439 | 257 | All SZGR 2.0 genes in this pathway |
YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
SHEDDEN LUNG CANCER GOOD SURVIVAL A4 | 196 | 124 | All SZGR 2.0 genes in this pathway |
MEISSNER BRAIN HCP WITH H3K27ME3 | 269 | 159 | All SZGR 2.0 genes in this pathway |
MEISSNER NPC HCP WITH H3K4ME2 AND H3K27ME3 | 349 | 234 | All SZGR 2.0 genes in this pathway |
MIKKELSEN NPC HCP WITH H3K27ME3 | 341 | 243 | All SZGR 2.0 genes in this pathway |
MIKKELSEN MEF HCP WITH H3K27ME3 | 590 | 403 | All SZGR 2.0 genes in this pathway |
PHESSE TARGETS OF APC AND MBD2 UP | 20 | 14 | All SZGR 2.0 genes in this pathway |
ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY | 1725 | 838 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-23 | 602 | 609 | 1A,m8 | hsa-miR-23abrain | AUCACAUUGCCAGGGAUUUCC |
hsa-miR-23bbrain | AUCACAUUGCCAGGGAUUACC | ||||
miR-338 | 158 | 164 | 1A | hsa-miR-338brain | UCCAGCAUCAGUGAUUUUGUUGA |
miR-495 | 594 | 600 | m8 | hsa-miR-495brain | AAACAAACAUGGUGCACUUCUUU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.