SZGR2

Summary ?

GeneID	7155
Symbol	TOP2B
Synonyms	TOPIIB\|top2beta
Description	topoisomerase (DNA) II beta
Reference	MIM:126431\|HGNC:HGNC:11990\|Ensembl:ENSG00000077097\|HPRD:00537\|Vega:OTTHUMG00000155596
Gene type	protein-coding
Map location	3p24
Pascal p-value	0.186
Sherlock p-value	0.387
Fetal beta	1.14
DMG	1 (# studies)

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Jaffe_2016	Genome-wide DNA methylation analysis	This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05.	1
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
GSMA_I	Genome scan meta-analysis	Psr: 0.006
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 3

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg18143863	3	25706824	TOP2B	2.18E-8	-0.013	7.35E-6	DMG:Jaffe_2016

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000166	nucleotide binding	IEA		-
GO:0003682	chromatin binding	IDA		9049244
GO:0003918	DNA topoisomerase (ATP-hydrolyzing) activity	IEA		-
GO:0005080	protein kinase C binding	IPI		16611985
GO:0005524	ATP binding	IEA		-
GO:0008022	protein C-terminus binding	IPI		10666337
GO:0042826	histone deacetylase binding	IPI		11062478 \|11136718
GO:0046982	protein heterodimerization activity	IPI		10473615
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007409	axonogenesis	IEA	neuron, axon, neurite (GO term level: 12)	-
GO:0001764	neuron migration	IEA	neuron (GO term level: 8)	-
GO:0030900	forebrain development	IEA	Brain (GO term level: 8)	-
GO:0006265	DNA topological change	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000792	heterochromatin	IDA		9049244
GO:0005829	cytosol	IDA		9049244
GO:0005634	nucleus	IDA		9049244
GO:0005654	nucleoplasm	IDA		9049244
GO:0005694	chromosome	IEA		-
GO:0005730	nucleolus	IDA		9049244
GO:0005737	cytoplasm	IEA		-

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
BAZ1B	WBSCR10 \| WBSCR9 \| WSTF	bromodomain adjacent to zinc finger domain, 1B	-	HPRD,BioGRID	12837248
CD3E	FLJ18683 \| T3E \| TCRE	CD3e molecule, epsilon (CD3-TCR complex)	-	HPRD,BioGRID	8626450
CSNK2B	CK2B \| CK2N \| CSK2B \| G5A \| MGC138222 \| MGC138224	casein kinase 2, beta polypeptide	-	HPRD,BioGRID	11710515
HDAC1	DKFZp686H12203 \| GON-10 \| HD1 \| RPD3 \| RPD3L1	histone deacetylase 1	Affinity Capture-Western Reconstituted Complex Two-hybrid	BioGRID	11062478 \|11136718
HDAC2	RPD3 \| YAF1	histone deacetylase 2	Affinity Capture-Western Reconstituted Complex	BioGRID	11062478
MAPK3	ERK1 \| HS44KDAP \| HUMKER1A \| MGC20180 \| P44ERK1 \| P44MAPK \| PRKM3	mitogen-activated protein kinase 3	ERK1 interacts with and phosphorylates Topoisomerase II-beta.	BIND	9155018
MTA2	DKFZp686F2281 \| MTA1L1 \| PID	metastasis associated 1 family, member 2	Affinity Capture-Western	BioGRID	11062478
SUMO1	DAP-1 \| GMP1 \| OFC10 \| PIC1 \| SENP2 \| SMT3 \| SMT3C \| SMT3H3 \| SUMO-1 \| UBL1	SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae)	-	HPRD,BioGRID	10862613
TOP2A	TOP2 \| TP2A	topoisomerase (DNA) II alpha 170kDa	-	HPRD,BioGRID	8710863
TOPBP1	TOP2BP1	topoisomerase (DNA) II binding protein 1	-	HPRD,BioGRID	9461304
TP53	FLJ92943 \| LFS1 \| TRP53 \| p53	tumor protein p53	-	HPRD,BioGRID	10666337
XPO1	CRM1 \| DKFZp686B1823	exportin 1 (CRM1 homolog, yeast)	-	HPRD	12821127

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
BIOCARTA DNAFRAGMENT PATHWAY	10	6	All SZGR 2.0 genes in this pathway
ONKEN UVEAL MELANOMA DN	526	357	All SZGR 2.0 genes in this pathway
TIEN INTESTINE PROBIOTICS 24HR UP	557	331	All SZGR 2.0 genes in this pathway
ENK UV RESPONSE KERATINOCYTE DN	485	334	All SZGR 2.0 genes in this pathway
BARIS THYROID CANCER DN	59	45	All SZGR 2.0 genes in this pathway
HAMAI APOPTOSIS VIA TRAIL UP	584	356	All SZGR 2.0 genes in this pathway
LASTOWSKA NEUROBLASTOMA COPY NUMBER DN	800	473	All SZGR 2.0 genes in this pathway
SCHLOSSER SERUM RESPONSE DN	712	443	All SZGR 2.0 genes in this pathway
MANN RESPONSE TO AMIFOSTINE UP	20	12	All SZGR 2.0 genes in this pathway
SIMBULAN UV RESPONSE IMMORTALIZED DN	31	26	All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK	1652	1023	All SZGR 2.0 genes in this pathway
PUJANA ATM PCC NETWORK	1442	892	All SZGR 2.0 genes in this pathway
LOPEZ MBD TARGETS	957	597	All SZGR 2.0 genes in this pathway
PASQUALUCCI LYMPHOMA BY GC STAGE DN	165	104	All SZGR 2.0 genes in this pathway
KAUFFMANN DNA REPAIR GENES	230	137	All SZGR 2.0 genes in this pathway
GOLUB ALL VS AML UP	24	20	All SZGR 2.0 genes in this pathway
TARTE PLASMA CELL VS PLASMABLAST DN	309	206	All SZGR 2.0 genes in this pathway
FLECHNER PBL KIDNEY TRANSPLANT OK VS DONOR UP	151	100	All SZGR 2.0 genes in this pathway
FLECHNER BIOPSY KIDNEY TRANSPLANT OK VS DONOR UP	555	346	All SZGR 2.0 genes in this pathway
HADDAD B LYMPHOCYTE PROGENITOR	293	193	All SZGR 2.0 genes in this pathway
LU AGING BRAIN DN	153	120	All SZGR 2.0 genes in this pathway
JI RESPONSE TO FSH DN	58	43	All SZGR 2.0 genes in this pathway
BURTON ADIPOGENESIS 11	57	40	All SZGR 2.0 genes in this pathway
BAELDE DIABETIC NEPHROPATHY DN	434	302	All SZGR 2.0 genes in this pathway
MARIADASON RESPONSE TO BUTYRATE SULINDAC 6	52	32	All SZGR 2.0 genes in this pathway
ZHENG BOUND BY FOXP3	491	310	All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 UNSTIMULATED	1229	713	All SZGR 2.0 genes in this pathway
ZHENG FOXP3 TARGETS IN THYMUS UP	196	137	All SZGR 2.0 genes in this pathway
RIZKI TUMOR INVASIVENESS 3D UP	210	124	All SZGR 2.0 genes in this pathway
BLUM RESPONSE TO SALIRASIB DN	342	220	All SZGR 2.0 genes in this pathway
WENDT COHESIN TARGETS UP	33	19	All SZGR 2.0 genes in this pathway
JISON SICKLE CELL DISEASE DN	181	97	All SZGR 2.0 genes in this pathway
YAGI AML WITH T 9 11 TRANSLOCATION	130	87	All SZGR 2.0 genes in this pathway
YAGI AML WITH 11Q23 REARRANGED	351	238	All SZGR 2.0 genes in this pathway
BOYLAN MULTIPLE MYELOMA PCA3 DN	69	38	All SZGR 2.0 genes in this pathway
VERHAAK GLIOBLASTOMA PRONEURAL	177	132	All SZGR 2.0 genes in this pathway
JOHNSTONE PARVB TARGETS 2 DN	336	211	All SZGR 2.0 genes in this pathway
DELACROIX RARG BOUND MEF	367	231	All SZGR 2.0 genes in this pathway
DELACROIX RAR BOUND ES	462	273	All SZGR 2.0 genes in this pathway
FORTSCHEGGER PHF8 TARGETS UP	279	155	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-23	92	98	m8	hsa-miR-23a^brain	AUCACAUUGCCAGGGAUUUCC
miR-23	92	98	m8	hsa-miR-23b^brain	AUCACAUUGCCAGGGAUUACC
miR-323	91	98	1A,m8	hsa-miR-323^brain	GCACAUUACACGGUCGACCUCU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: TOP2B