Gene Page: TOP2B
Summary ?
GeneID | 7155 |
Symbol | TOP2B |
Synonyms | TOPIIB|top2beta |
Description | topoisomerase (DNA) II beta |
Reference | MIM:126431|HGNC:HGNC:11990|Ensembl:ENSG00000077097|HPRD:00537|Vega:OTTHUMG00000155596 |
Gene type | protein-coding |
Map location | 3p24 |
Pascal p-value | 0.186 |
Sherlock p-value | 0.387 |
Fetal beta | 1.14 |
DMG | 1 (# studies) |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
GSMA_I | Genome scan meta-analysis | Psr: 0.006 | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 3 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg18143863 | 3 | 25706824 | TOP2B | 2.18E-8 | -0.013 | 7.35E-6 | DMG:Jaffe_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0000166 | nucleotide binding | IEA | - | |
GO:0003682 | chromatin binding | IDA | 9049244 | |
GO:0003918 | DNA topoisomerase (ATP-hydrolyzing) activity | IEA | - | |
GO:0005080 | protein kinase C binding | IPI | 16611985 | |
GO:0005524 | ATP binding | IEA | - | |
GO:0008022 | protein C-terminus binding | IPI | 10666337 | |
GO:0042826 | histone deacetylase binding | IPI | 11062478 |11136718 | |
GO:0046982 | protein heterodimerization activity | IPI | 10473615 | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007409 | axonogenesis | IEA | neuron, axon, neurite (GO term level: 12) | - |
GO:0001764 | neuron migration | IEA | neuron (GO term level: 8) | - |
GO:0030900 | forebrain development | IEA | Brain (GO term level: 8) | - |
GO:0006265 | DNA topological change | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0000792 | heterochromatin | IDA | 9049244 | |
GO:0005829 | cytosol | IDA | 9049244 | |
GO:0005634 | nucleus | IDA | 9049244 | |
GO:0005654 | nucleoplasm | IDA | 9049244 | |
GO:0005694 | chromosome | IEA | - | |
GO:0005730 | nucleolus | IDA | 9049244 | |
GO:0005737 | cytoplasm | IEA | - |
Section IV. Protein-protein interaction annotation
Interactors | Aliases B | Official full name B | Experimental | Source | PubMed ID |
---|---|---|---|---|---|
BAZ1B | WBSCR10 | WBSCR9 | WSTF | bromodomain adjacent to zinc finger domain, 1B | - | HPRD,BioGRID | 12837248 |
CD3E | FLJ18683 | T3E | TCRE | CD3e molecule, epsilon (CD3-TCR complex) | - | HPRD,BioGRID | 8626450 |
CSNK2B | CK2B | CK2N | CSK2B | G5A | MGC138222 | MGC138224 | casein kinase 2, beta polypeptide | - | HPRD,BioGRID | 11710515 |
HDAC1 | DKFZp686H12203 | GON-10 | HD1 | RPD3 | RPD3L1 | histone deacetylase 1 | Affinity Capture-Western Reconstituted Complex Two-hybrid | BioGRID | 11062478 |11136718 |
HDAC2 | RPD3 | YAF1 | histone deacetylase 2 | Affinity Capture-Western Reconstituted Complex | BioGRID | 11062478 |
MAPK3 | ERK1 | HS44KDAP | HUMKER1A | MGC20180 | P44ERK1 | P44MAPK | PRKM3 | mitogen-activated protein kinase 3 | ERK1 interacts with and phosphorylates Topoisomerase II-beta. | BIND | 9155018 |
MTA2 | DKFZp686F2281 | MTA1L1 | PID | metastasis associated 1 family, member 2 | Affinity Capture-Western | BioGRID | 11062478 |
SUMO1 | DAP-1 | GMP1 | OFC10 | PIC1 | SENP2 | SMT3 | SMT3C | SMT3H3 | SUMO-1 | UBL1 | SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) | - | HPRD,BioGRID | 10862613 |
TOP2A | TOP2 | TP2A | topoisomerase (DNA) II alpha 170kDa | - | HPRD,BioGRID | 8710863 |
TOPBP1 | TOP2BP1 | topoisomerase (DNA) II binding protein 1 | - | HPRD,BioGRID | 9461304 |
TP53 | FLJ92943 | LFS1 | TRP53 | p53 | tumor protein p53 | - | HPRD,BioGRID | 10666337 |
XPO1 | CRM1 | DKFZp686B1823 | exportin 1 (CRM1 homolog, yeast) | - | HPRD | 12821127 |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
BIOCARTA DNAFRAGMENT PATHWAY | 10 | 6 | All SZGR 2.0 genes in this pathway |
ONKEN UVEAL MELANOMA DN | 526 | 357 | All SZGR 2.0 genes in this pathway |
TIEN INTESTINE PROBIOTICS 24HR UP | 557 | 331 | All SZGR 2.0 genes in this pathway |
ENK UV RESPONSE KERATINOCYTE DN | 485 | 334 | All SZGR 2.0 genes in this pathway |
BARIS THYROID CANCER DN | 59 | 45 | All SZGR 2.0 genes in this pathway |
HAMAI APOPTOSIS VIA TRAIL UP | 584 | 356 | All SZGR 2.0 genes in this pathway |
LASTOWSKA NEUROBLASTOMA COPY NUMBER DN | 800 | 473 | All SZGR 2.0 genes in this pathway |
SCHLOSSER SERUM RESPONSE DN | 712 | 443 | All SZGR 2.0 genes in this pathway |
MANN RESPONSE TO AMIFOSTINE UP | 20 | 12 | All SZGR 2.0 genes in this pathway |
SIMBULAN UV RESPONSE IMMORTALIZED DN | 31 | 26 | All SZGR 2.0 genes in this pathway |
PUJANA BRCA1 PCC NETWORK | 1652 | 1023 | All SZGR 2.0 genes in this pathway |
PUJANA ATM PCC NETWORK | 1442 | 892 | All SZGR 2.0 genes in this pathway |
LOPEZ MBD TARGETS | 957 | 597 | All SZGR 2.0 genes in this pathway |
PASQUALUCCI LYMPHOMA BY GC STAGE DN | 165 | 104 | All SZGR 2.0 genes in this pathway |
KAUFFMANN DNA REPAIR GENES | 230 | 137 | All SZGR 2.0 genes in this pathway |
GOLUB ALL VS AML UP | 24 | 20 | All SZGR 2.0 genes in this pathway |
TARTE PLASMA CELL VS PLASMABLAST DN | 309 | 206 | All SZGR 2.0 genes in this pathway |
FLECHNER PBL KIDNEY TRANSPLANT OK VS DONOR UP | 151 | 100 | All SZGR 2.0 genes in this pathway |
FLECHNER BIOPSY KIDNEY TRANSPLANT OK VS DONOR UP | 555 | 346 | All SZGR 2.0 genes in this pathway |
HADDAD B LYMPHOCYTE PROGENITOR | 293 | 193 | All SZGR 2.0 genes in this pathway |
LU AGING BRAIN DN | 153 | 120 | All SZGR 2.0 genes in this pathway |
JI RESPONSE TO FSH DN | 58 | 43 | All SZGR 2.0 genes in this pathway |
BURTON ADIPOGENESIS 11 | 57 | 40 | All SZGR 2.0 genes in this pathway |
BAELDE DIABETIC NEPHROPATHY DN | 434 | 302 | All SZGR 2.0 genes in this pathway |
MARIADASON RESPONSE TO BUTYRATE SULINDAC 6 | 52 | 32 | All SZGR 2.0 genes in this pathway |
ZHENG BOUND BY FOXP3 | 491 | 310 | All SZGR 2.0 genes in this pathway |
MARSON BOUND BY FOXP3 UNSTIMULATED | 1229 | 713 | All SZGR 2.0 genes in this pathway |
ZHENG FOXP3 TARGETS IN THYMUS UP | 196 | 137 | All SZGR 2.0 genes in this pathway |
RIZKI TUMOR INVASIVENESS 3D UP | 210 | 124 | All SZGR 2.0 genes in this pathway |
BLUM RESPONSE TO SALIRASIB DN | 342 | 220 | All SZGR 2.0 genes in this pathway |
WENDT COHESIN TARGETS UP | 33 | 19 | All SZGR 2.0 genes in this pathway |
JISON SICKLE CELL DISEASE DN | 181 | 97 | All SZGR 2.0 genes in this pathway |
YAGI AML WITH T 9 11 TRANSLOCATION | 130 | 87 | All SZGR 2.0 genes in this pathway |
YAGI AML WITH 11Q23 REARRANGED | 351 | 238 | All SZGR 2.0 genes in this pathway |
BOYLAN MULTIPLE MYELOMA PCA3 DN | 69 | 38 | All SZGR 2.0 genes in this pathway |
VERHAAK GLIOBLASTOMA PRONEURAL | 177 | 132 | All SZGR 2.0 genes in this pathway |
JOHNSTONE PARVB TARGETS 2 DN | 336 | 211 | All SZGR 2.0 genes in this pathway |
DELACROIX RARG BOUND MEF | 367 | 231 | All SZGR 2.0 genes in this pathway |
DELACROIX RAR BOUND ES | 462 | 273 | All SZGR 2.0 genes in this pathway |
FORTSCHEGGER PHF8 TARGETS UP | 279 | 155 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-23 | 92 | 98 | m8 | hsa-miR-23abrain | AUCACAUUGCCAGGGAUUUCC |
hsa-miR-23bbrain | AUCACAUUGCCAGGGAUUACC | ||||
miR-323 | 91 | 98 | 1A,m8 | hsa-miR-323brain | GCACAUUACACGGUCGACCUCU |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.