SZGR2

Summary ?

GeneID	7329
Symbol	UBE2I
Synonyms	C358B7.1\|P18\|UBC9
Description	ubiquitin conjugating enzyme E2 I
Reference	MIM:601661\|HGNC:HGNC:12485\|Ensembl:ENSG00000103275\|HPRD:09045\|Vega:OTTHUMG00000186701
Gene type	protein-coding
Map location	16p13.3
Pascal p-value	0.05
Sherlock p-value	0.393
Fetal beta	0.751
DMG	1 (# studies)
eGene	Meta

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Jaffe_2016	Genome-wide DNA methylation analysis	This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05.	1
Network	Shortest path distance of core genes in the Human protein-protein interaction network	Contribution to shortest path in PPI network: 0.0725

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg07982263	16	1359166	UBE2I	9.53E-8	-0.006	2.14E-5	DMG:Jaffe_2016

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
TRA2B	0.92	0.89
DKC1	0.91	0.90
SFRS3	0.91	0.89
EIF4A3	0.90	0.90
MED17	0.90	0.91
MCM6	0.90	0.91
UBE2I	0.90	0.90
NUP107	0.89	0.91
ZIK1	0.89	0.88
SFRS7	0.89	0.89

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
HLA-F	-0.69	-0.76
MT-CO2	-0.68	-0.81
AF347015.33	-0.68	-0.81
AF347015.27	-0.68	-0.80
AF347015.31	-0.67	-0.80
MT-CYB	-0.66	-0.79
TINAGL1	-0.66	-0.75
AIFM3	-0.65	-0.72
AF347015.8	-0.65	-0.80
PTH1R	-0.65	-0.74

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005515	protein binding	IPI		9885291 \|12072434 \|14516784
GO:0016874	ligase activity	IEA		-
GO:0019787	small conjugating protein ligase activity	IEA		-
GO:0043398	HLH domain binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006511	ubiquitin-dependent protein catabolic process	IEA		-
GO:0006511	ubiquitin-dependent protein catabolic process	TAS		8565643
GO:0007049	cell cycle	IEA		-
GO:0007067	mitosis	IEA		-
GO:0007059	chromosome segregation	IEA		-
GO:0051246	regulation of protein metabolic process	IEA		-
GO:0051301	cell division	IEA		-
GO:0043687	post-translational protein modification	IEA		-
GO:0044419	interspecies interaction between organisms	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0000795	synaptonemal complex	TAS		8610150
GO:0005634	nucleus	IEA		-
GO:0016605	PML body	IDA		9885291

Section IV. Protein-protein interaction annotation

Interactors	Aliases B	Official full name B	Experimental	Source	PubMed ID
APEX1	APE \| APE-1 \| APE1 \| APEN \| APEX \| APX \| HAP1 \| REF-1 \| REF1	APEX nuclease (multifunctional DNA repair enzyme) 1	-	HPRD,BioGRID	12110916
AR	AIS \| DHTR \| HUMARA \| KD \| NR3C4 \| SBMA \| SMAX1 \| TFM	androgen receptor	Affinity Capture-Western Phenotypic Enhancement Two-hybrid	BioGRID	10383460
AR	AIS \| DHTR \| HUMARA \| KD \| NR3C4 \| SBMA \| SMAX1 \| TFM	androgen receptor	-	HPRD	8798622
ATF2	CRE-BP1 \| CREB2 \| HB16 \| MGC111558 \| TREB7	activating transcription factor 2	-	HPRD,BioGRID	9488727
BLMH	BH \| BMH	bleomycin hydrolase	Affinity Capture-Western Reconstituted Complex Two-hybrid	BioGRID	9855622
C18orf25	ARKL1 \| MGC12909 \| MGC87799	chromosome 18 open reading frame 25	Two-hybrid	BioGRID	16189514
CBX4	NBP16 \| PC2 \| hPC2	chromobox homolog 4 (Pc class homolog, Drosophila)	Ubc9 interacts with Pc2.	BIND	15592428
CEBPE	C/EBP-epsilon \| CRP1	CCAAT/enhancer binding protein (C/EBP), epsilon	C/EBP-epsilon interacts with UBE2I.	BIND	15588942
CHD3	Mi-2a \| Mi2-ALPHA \| ZFH	chromodomain helicase DNA binding protein 3	-	HPRD,BioGRID	14609633
CHD3	Mi-2a \| Mi2-ALPHA \| ZFH	chromodomain helicase DNA binding protein 3	Ubc9 interacts with CHD3.	BIND	14609633
CHMP4B	C20orf178 \| CHMP4A \| CTPP3 \| SNF7 \| SNF7-2 \| Shax1 \| dJ553F4.4	chromatin modifying protein 4B	Two-hybrid	BioGRID	16189514
CHUK	IKBKA \| IKK-alpha \| IKK1 \| IKKA \| NFKBIKA \| TCF16	conserved helix-loop-helix ubiquitous kinase	Biochemical Activity	BioGRID	11853669
DACH1	DACH \| FLJ10138	dachshund homolog 1 (Drosophila)	-	HPRD,BioGRID	11025202
DAXX	BING2 \| DAP6 \| EAP1 \| MGC126245 \| MGC126246	death-domain associated protein	Daxx interacts with Ubc9.	BIND	11112409
DAXX	BING2 \| DAP6 \| EAP1 \| MGC126245 \| MGC126246	death-domain associated protein	Biochemical Activity Two-hybrid	BioGRID	11112409 \|18691969
DNMT3A	DNMT3A2 \| M.HsaIIIA	DNA (cytosine-5-)-methyltransferase 3 alpha	-	HPRD,BioGRID	14752048
DNMT3B	ICF \| M.HsaIIIB	DNA (cytosine-5-)-methyltransferase 3 beta	Dnmt3b interacts with Ubc9.	BIND	11735126
DNMT3B	ICF \| M.HsaIIIB	DNA (cytosine-5-)-methyltransferase 3 beta	-	HPRD,BioGRID	11735126
EP300	KAT3B \| p300	E1A binding protein p300	-	HPRD	8824223
ESR1	DKFZp686N23123 \| ER \| ESR \| ESRA \| Era \| NR3A1	estrogen receptor 1	ER-alpha interacts with an unspecified isoform of Ubc9.	BIND	15666801
ETS1	ETS-1 \| EWSR2 \| FLJ10768	v-ets erythroblastosis virus E26 oncogene homolog 1 (avian)	-	HPRD,BioGRID	9333025
ETV6	TEL \| TEL/ABL	ets variant 6	-	HPRD	10377438
FAS	ALPS1A \| APO-1 \| APT1 \| CD95 \| FAS1 \| FASTM \| TNFRSF6	Fas (TNF receptor superfamily, member 6)	-	HPRD,BioGRID	9257699
FHIT	AP3Aase \| FRA3B	fragile histidine triad gene	-	HPRD,BioGRID	11085938
FMR1	FMRP \| FRAXA \| MGC87458 \| POF \| POF1	fragile X mental retardation 1	-	HPRD,BioGRID	11367701
HDAC4	HA6116 \| HD4 \| HDAC-A \| HDACA \| KIAA0288	histone deacetylase 4	Biochemical Activity	BioGRID	18691969
HGS	HRS \| ZFYVE8	hepatocyte growth factor-regulated tyrosine kinase substrate	Two-hybrid	BioGRID	16189514
HIPK2	DKFZp686K02111 \| FLJ23711 \| PRO0593	homeodomain interacting protein kinase 2	Ubc9 with HIPK2.	BIND	14609633
HIPK2	DKFZp686K02111 \| FLJ23711 \| PRO0593	homeodomain interacting protein kinase 2	Two-hybrid	BioGRID	14609633
HIPK2	DKFZp686K02111 \| FLJ23711 \| PRO0593	homeodomain interacting protein kinase 2	-	HPRD	10535925
HNRNPC	C1 \| C2 \| HNRNP \| HNRPC \| MGC104306 \| MGC105117 \| MGC117353 \| MGC131677 \| SNRPC	heterogeneous nuclear ribonucleoprotein C (C1/C2)	Two-hybrid	BioGRID	16189514
HNRNPK	CSBP \| FLJ41122 \| HNRPK \| TUNP	heterogeneous nuclear ribonucleoprotein K	Two-hybrid	BioGRID	16189514
HSF2	MGC117376 \| MGC156196 \| MGC75048	heat shock transcription factor 2	Two-hybrid	BioGRID	11278381
IKZF1	Hs.54452 \| IK1 \| IKAROS \| LYF1 \| PRO0758 \| ZNFN1A1 \| hIk-1	IKAROS family zinc finger 1 (Ikaros)	Two-hybrid	BioGRID	16189514
IKZF3	AIO \| AIOLOS \| ZNFN1A3	IKAROS family zinc finger 3 (Aiolos)	Two-hybrid	BioGRID	16189514
IPO13	IMP13 \| KAP13 \| KIAA0724 \| RANBP13	importin 13	-	HPRD,BioGRID	11447110
JUN	AP-1 \| AP1 \| c-Jun	jun oncogene	-	HPRD,BioGRID	8733011
KCNK1	DPK \| HOHO \| K2p1.1 \| KCNO1 \| TWIK-1 \| TWIK1	potassium channel, subfamily K, member 1	K2P1 interacts with Ubc-9.	BIND	15820677
MAP3K1	MAPKKK1 \| MEKK \| MEKK1	mitogen-activated protein kinase kinase kinase 1	Reconstituted Complex Two-hybrid	BioGRID	9563508
MAPK1IP1L	C14orf32 \| MGC23138 \| MISS \| c14_5346	mitogen-activated protein kinase 1 interacting protein 1-like	Two-hybrid	BioGRID	16189514
MITF	MI \| WS2A \| bHLHe32	microphthalmia-associated transcription factor	-	HPRD,BioGRID	10694430
MYB	Cmyb \| c-myb \| c-myb_CDS \| efg	v-myb myeloblastosis viral oncogene homolog (avian)	-	HPRD	11779867
NR3C1	GCCR \| GCR \| GR \| GRL	nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor)	-	HPRD	11812797
NUDCD3	KIAA1068 \| NudCL	NudC domain containing 3	Two-hybrid	BioGRID	16189514
PDLIM7	LMP1	PDZ and LIM domain 7 (enigma)	Two-hybrid	BioGRID	16189514
PDZK1	CAP70 \| CLAMP \| NHERF3 \| PDZD1	PDZ domain containing 1	Two-hybrid	BioGRID	14531806
PHC1	EDR1 \| HPH1 \| RAE28	polyhomeotic homolog 1 (Drosophila)	Two-hybrid	BioGRID	16189514
PIAS1	DDXBP1 \| GBP \| GU/RH-II \| MGC141878 \| MGC141879 \| ZMIZ3	protein inhibitor of activated STAT, 1	Ubc9 interacts with PIAS1.	BIND	14609633
PIAS1	DDXBP1 \| GBP \| GU/RH-II \| MGC141878 \| MGC141879 \| ZMIZ3	protein inhibitor of activated STAT, 1	-	HPRD	12177000
PIAS1	DDXBP1 \| GBP \| GU/RH-II \| MGC141878 \| MGC141879 \| ZMIZ3	protein inhibitor of activated STAT, 1	Reconstituted Complex Two-hybrid	BioGRID	11583632 \|12356736 \|14609633
PIAS2	MGC102682 \| MIZ1 \| PIASX \| PIASX-ALPHA \| PIASX-BETA \| SIZ2 \| ZMIZ4 \| miz	protein inhibitor of activated STAT, 2	Two-hybrid	BioGRID	14609633 \|16189514
PIAS2	MGC102682 \| MIZ1 \| PIASX \| PIASX-ALPHA \| PIASX-BETA \| SIZ2 \| ZMIZ4 \| miz	protein inhibitor of activated STAT, 2	Ubc9 interacts with PIASxb-eta.	BIND	14609633
PML	MYL \| PP8675 \| RNF71 \| TRIM19	promyelocytic leukemia	Biochemical Activity	BioGRID	18691969
PPM1J	DKFZp434P1514 \| FLJ35951 \| MGC19531 \| MGC90149 \| PP2CZ \| PP2Czeta \| PPP2CZ	protein phosphatase 1J (PP2C domain containing)	-	HPRD,BioGRID	12633878
PTEN	10q23del \| BZS \| MGC11227 \| MHAM \| MMAC1 \| PTEN1 \| TEP1	phosphatase and tensin homolog	Affinity Capture-Western	BioGRID	12620973
RAD51	BRCC5 \| HRAD51 \| HsRad51 \| HsT16930 \| RAD51A \| RECA	RAD51 homolog (RecA homolog, E. coli) (S. cerevisiae)	-	HPRD,BioGRID	8610150
RAD52	-	RAD52 homolog (S. cerevisiae)	Two-hybrid	BioGRID	8921390
RAD54B	FSBP \| RDH54	RAD54 homolog B (S. cerevisiae)	Two-hybrid	BioGRID	16189514
RANBP2	NUP358 \| TRP1 \| TRP2	RAN binding protein 2	Ubc9 interacts with RanBP2.	BIND	15608651
RANBP2	NUP358 \| TRP1 \| TRP2	RAN binding protein 2	RanBP2 interacts with Ubc9.	BIND	15378033
RANBP2	NUP358 \| TRP1 \| TRP2	RAN binding protein 2	-	HPRD,BioGRID	12192048
RANGAP1	Fug1 \| KIAA1835 \| MGC20266 \| SD	Ran GTPase activating protein 1	Affinity Capture-MS Biochemical Activity Reconstituted Complex	BioGRID	12924945 \|17353931 \|18691969
RANGAP1	Fug1 \| KIAA1835 \| MGC20266 \| SD	Ran GTPase activating protein 1	Unspecified isoform of UBC9 conjugated with SUMO-1 sumoylates RanGAP1. This interaction was modeled on a demonstrated interaction between UBC9 from an unspecified species and RanGAP1 from an unspecified species.	BIND	15546615
RANGAP1	Fug1 \| KIAA1835 \| MGC20266 \| SD	Ran GTPase activating protein 1	-	HPRD	11853669
RB1	OSRC \| RB \| p105-Rb \| pRb \| pp110	retinoblastoma 1	RB1 (pRb) interacts with, and is sumoylated by, an unspecified isoform of UBE2I (Ubc9).	BIND	15806172
RIPK2	CARD3 \| CARDIAK \| CCK \| GIG30 \| RICK \| RIP2	receptor-interacting serine-threonine kinase 2	Two-hybrid	BioGRID	16189514
SAE1	AOS1 \| FLJ3091 \| HSPC140 \| SUA1	SUMO1 activating enzyme subunit 1	Affinity Capture-MS	BioGRID	17353931
SALL1	HSAL1 \| TBS \| ZNF794	sal-like 1 (Drosophila)	SALL1 interacts with UBE2I.	BIND	12200128
SALL1	HSAL1 \| TBS \| ZNF794	sal-like 1 (Drosophila)	-	HPRD,BioGRID	12200128
SATB1	-	SATB homeobox 1	Two-hybrid	BioGRID	16189514
SCNN1A	ENaCa \| ENaCalpha \| FLJ21883 \| SCNEA \| SCNN1	sodium channel, nonvoltage-gated 1 alpha	-	HPRD,BioGRID	14556380
SIAH1	FLJ08065 \| HUMSIAH \| Siah-1 \| Siah-1a \| hSIAH1	seven in absentia homolog 1 (Drosophila)	Ubc9 interacts with Siah-1.	BIND	9334332
SIAH1	FLJ08065 \| HUMSIAH \| Siah-1 \| Siah-1a \| hSIAH1	seven in absentia homolog 1 (Drosophila)	hSiah1 interacts with Ubc9.	BIND	9334332
SIAH2	hSiah2	seven in absentia homolog 2 (Drosophila)	hSiah2 interacts with Ubc9.	BIND	9334332
SIAH2	hSiah2	seven in absentia homolog 2 (Drosophila)	Ubc9 interacts with Siah-2.	BIND	9334332
SLC2A1	DYT17 \| DYT18 \| GLUT \| GLUT1 \| MGC141895 \| MGC141896 \| PED	solute carrier family 2 (facilitated glucose transporter), member 1	-	HPRD	11842083
SLC2A4	GLUT4	solute carrier family 2 (facilitated glucose transporter), member 4	-	HPRD	11842083
SMAD4	DPC4 \| JIP \| MADH4	SMAD family member 4	Two-hybrid	BioGRID	16189514
SP100	DKFZp686E07254 \| FLJ00340 \| FLJ34579	SP100 nuclear antigen	Biochemical Activity Reconstituted Complex	BioGRID	18691969
SREBF1	SREBP-1c \| SREBP1 \| bHLHd1	sterol regulatory element binding transcription factor 1	-	HPRD,BioGRID	12615929
SREBF2	SREBP2 \| bHLHd2	sterol regulatory element binding transcription factor 2	-	HPRD,BioGRID	12615929
STAT1	DKFZp686B04100 \| ISGF-3 \| STAT91	signal transducer and activator of transcription 1, 91kDa	-	HPRD	12356736
SUMO1	DAP-1 \| GMP1 \| OFC10 \| PIC1 \| SENP2 \| SMT3 \| SMT3C \| SMT3H3 \| SUMO-1 \| UBL1	SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae)	-	HPRD,BioGRID	12924945
SUMO1	DAP-1 \| GMP1 \| OFC10 \| PIC1 \| SENP2 \| SMT3 \| SMT3C \| SMT3H3 \| SUMO-1 \| UBL1	SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae)	Ubc9 interacts with SUMO1.	BIND	15592428
SUMO1	DAP-1 \| GMP1 \| OFC10 \| PIC1 \| SENP2 \| SMT3 \| SMT3C \| SMT3H3 \| SUMO-1 \| UBL1	SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae)	hUbc9 interacts with SUMO-1.	BIND	9920803
SUMO2	HSMT3 \| MGC117191 \| SMT3B \| SMT3H2	SMT3 suppressor of mif two 3 homolog 2 (S. cerevisiae)	-	HPRD	12924945
SUMO3	SMT3A \| SMT3H1 \| SUMO-3	SMT3 suppressor of mif two 3 homolog 3 (S. cerevisiae)	Affinity Capture-MS	BioGRID	17353931
SUMO3	SMT3A \| SMT3H1 \| SUMO-3	SMT3 suppressor of mif two 3 homolog 3 (S. cerevisiae)	-	HPRD	12924945
TCF3	E2A \| ITF1 \| MGC129647 \| MGC129648 \| bHLHb21	transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47)	Reconstituted Complex Two-hybrid	BioGRID	10497239
TDG	-	thymine-DNA glycosylase	Biochemical Activity	BioGRID	18691969
TNFRSF1A	CD120a \| FPF \| MGC19588 \| TBP1 \| TNF-R \| TNF-R-I \| TNF-R55 \| TNFAR \| TNFR1 \| TNFR55 \| TNFR60 \| p55 \| p55-R \| p60	tumor necrosis factor receptor superfamily, member 1A	-	HPRD,BioGRID	9563508
TOP1	TOPI	topoisomerase (DNA) I	-	HPRD,BioGRID	10759568
TOPORS	LUN \| P53BP3 \| RP31 \| TP53BPL	topoisomerase I binding, arginine/serine-rich	-	HPRD,BioGRID	14516784
TP53	FLJ92943 \| LFS1 \| TRP53 \| p53	tumor protein p53	-	HPRD,BioGRID	8921390
TP53	FLJ92943 \| LFS1 \| TRP53 \| p53	tumor protein p53	p53 interacts with Ubc9. This interaction was modelled on a demonstrated interaction between p53 from human and Ubc9 from an unspecified species.	BIND	10788439
TP53	FLJ92943 \| LFS1 \| TRP53 \| p53	tumor protein p53	UBE2I interacts with TP53. This interaction was modelled on a demonstrated interaction between D. melanogaster Lwr (DmUbc9) and p53 from an unspecified species.	BIND	9514881
TP73	P73	tumor protein p73	Two-hybrid	BioGRID	10961991
TRAF4	CART1 \| MLN62 \| RNF83	TNF receptor-associated factor 4	TRAF4 interacts with UBC9.	BIND	12023963
TRIM29	ATDC \| FLJ36085	tripartite motif-containing 29	Two-hybrid	BioGRID	16189514
TRIM54	MURF \| MURF-3 \| RNF30	tripartite motif-containing 54	Two-hybrid	BioGRID	11927605
TRIM55	MURF-2 \| RNF29	tripartite motif-containing 55	Two-hybrid	BioGRID	11927605
TRIM63	FLJ32380 \| IRF \| MURF1 \| MURF2 \| RNF28 \| SMRZ	tripartite motif-containing 63	Two-hybrid	BioGRID	11927605
TTRAP	AD022 \| EAP2 \| MGC111021 \| MGC9099 \| dJ30M3.3	TRAF and TNF receptor associated protein	Two-hybrid	BioGRID	14609633
TTRAP	AD022 \| EAP2 \| MGC111021 \| MGC9099 \| dJ30M3.3	TRAF and TNF receptor associated protein	Ubc9 interacts with TTRAP.	BIND	14609633
UBA2	ARX \| FLJ13058 \| HRIHFB2115 \| SAE2	ubiquitin-like modifier activating enzyme 2	Affinity Capture-MS Biochemical Activity	BioGRID	17353931 \|18691969
UBE2I	C358B7.1 \| P18 \| UBC9	ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast)	Two-hybrid	BioGRID	8610150
UBE2K	DKFZp564C1216 \| DKFZp686J24237 \| E2-25K \| HIP2 \| HYPG \| LIG	ubiquitin-conjugating enzyme E2K (UBC1 homolog, yeast)	Biochemical Activity	BioGRID	18691969
UCHL1	PARK5 \| PGP9.5 \| Uch-L1	ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase)	Two-hybrid	BioGRID	12082530
UNC119	HRG4	unc-119 homolog (C. elegans)	Two-hybrid	BioGRID	16169070
WT1	GUD \| WAGR \| WIT-2 \| WT33	Wilms tumor 1	-	HPRD,BioGRID	8798754
ZBED1	ALTE \| DREF \| KIAA0785 \| TRAMP \| hDREF	zinc finger, BED-type containing 1	Two-hybrid	BioGRID	16189514
ZNF451	COASTER \| FLJ23421 \| FLJ53246 \| FLJ90693 \| KIAA0576 \| KIAA1702 \| MGC26701 \| dJ417I1.1	zinc finger protein 451	Two-hybrid	BioGRID	16189514
ZNF646	KIAA0296	zinc finger protein 646	Two-hybrid	BioGRID	16189514

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG UBIQUITIN MEDIATED PROTEOLYSIS	138	98	All SZGR 2.0 genes in this pathway
PID HDAC CLASSII PATHWAY	34	27	All SZGR 2.0 genes in this pathway
PID AR PATHWAY	61	46	All SZGR 2.0 genes in this pathway
PID HDAC CLASSI PATHWAY	66	50	All SZGR 2.0 genes in this pathway
PID RANBP2 PATHWAY	11	11	All SZGR 2.0 genes in this pathway
PID CMYB PATHWAY	84	61	All SZGR 2.0 genes in this pathway
PID SMAD2 3PATHWAY	17	13	All SZGR 2.0 genes in this pathway
REACTOME MEIOSIS	116	81	All SZGR 2.0 genes in this pathway
REACTOME CELL CYCLE	421	253	All SZGR 2.0 genes in this pathway
REACTOME CHROMOSOME MAINTENANCE	122	80	All SZGR 2.0 genes in this pathway
REACTOME MEIOTIC SYNAPSIS	73	57	All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS DN	536	332	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY SERUM DEPRIVATION UP	552	347	All SZGR 2.0 genes in this pathway
GRAESSMANN APOPTOSIS BY DOXORUBICIN UP	1142	669	All SZGR 2.0 genes in this pathway
GRAESSMANN RESPONSE TO MC AND DOXORUBICIN UP	612	367	All SZGR 2.0 genes in this pathway
MARTIN INTERACT WITH HDAC	44	31	All SZGR 2.0 genes in this pathway
LI AMPLIFIED IN LUNG CANCER	178	108	All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK	1652	1023	All SZGR 2.0 genes in this pathway
PUJANA BRCA2 PCC NETWORK	423	265	All SZGR 2.0 genes in this pathway
PUJANA CHEK2 PCC NETWORK	779	480	All SZGR 2.0 genes in this pathway
NUYTTEN EZH2 TARGETS DN	1024	594	All SZGR 2.0 genes in this pathway
LOPEZ MBD TARGETS	957	597	All SZGR 2.0 genes in this pathway
SCHAEFFER PROSTATE DEVELOPMENT 6HR DN	514	330	All SZGR 2.0 genes in this pathway
KAUFFMANN DNA REPAIR GENES	230	137	All SZGR 2.0 genes in this pathway
NIKOLSKY BREAST CANCER 16P13 AMPLICON	120	49	All SZGR 2.0 genes in this pathway
NIKOLSKY MUTATED AND AMPLIFIED IN BREAST CANCER	94	60	All SZGR 2.0 genes in this pathway
FLECHNER PBL KIDNEY TRANSPLANT OK VS DONOR UP	151	100	All SZGR 2.0 genes in this pathway
BYSTRYKH HEMATOPOIESIS STEM CELL QTL TRANS	882	572	All SZGR 2.0 genes in this pathway
KAAB FAILED HEART ATRIUM DN	141	99	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 48HR DN	504	323	All SZGR 2.0 genes in this pathway
SESTO RESPONSE TO UV C1	72	45	All SZGR 2.0 genes in this pathway
JIANG HYPOXIA CANCER	83	52	All SZGR 2.0 genes in this pathway
RIZKI TUMOR INVASIVENESS 3D UP	210	124	All SZGR 2.0 genes in this pathway
CHAUHAN RESPONSE TO METHOXYESTRADIOL DN	102	65	All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA CHEMOTAXIS DN	457	302	All SZGR 2.0 genes in this pathway
MILI PSEUDOPODIA HAPTOTAXIS DN	668	419	All SZGR 2.0 genes in this pathway
ROME INSULIN TARGETS IN MUSCLE UP	442	263	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-188	29	35	m8	hsa-miR-188	CAUCCCUUGCAUGGUGGAGGGU
miR-200bc/429	256	262	m8	hsa-miR-200b	UAAUACUGCCUGGUAAUGAUGAC
				hsa-miR-200c	UAAUACUGCCGGGUAAUGAUGG
				hsa-miR-429	UAAUACUGUCUGGUAAAACCGU
miR-30-5p	52	59	1A,m8	hsa-miR-30a-5p	UGUAAACAUCCUCGACUGGAAG
				hsa-miR-30c^brain	UGUAAACAUCCUACACUCUCAGC
				hsa-miR-30d^SZ	UGUAAACAUCCCCGACUGGAAG
				hsa-miR-30b^SZ	UGUAAACAUCCUACACUCAGCU
				hsa-miR-30e-5p	UGUAAACAUCCUUGACUGGA
miR-324-5p	329	336	1A,m8	hsa-miR-324-5p	CGCAUCCCCUAGGGCAUUGGUGU
miR-410	549	555	1A	hsa-miR-410	AAUAUAACACAGAUGGCCUGU
miR-485-5p	453	459	1A	hsa-miR-485-5p	AGAGGCUGGCCGUGAUGAAUUC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: UBE2I