SZGR2

Summary ?

GeneID	777
Symbol	CACNA1E
Synonyms	BII\|CACH6\|CACNL1A6\|Cav2.3
Description	calcium voltage-gated channel subunit alpha1 E
Reference	MIM:601013\|HGNC:HGNC:1392\|Ensembl:ENSG00000198216\|HPRD:03006\|Vega:OTTHUMG00000037301
Gene type	protein-coding
Map location	1q25.3
Fetal beta	0.256
eGene	Meta
Support	CANABINOID DOPAMINE EXCITABILITY METABOTROPIC GLUTAMATE RECEPTOR SEROTONIN G2Cdb.human_BAYES-COLLINS-MOUSE-PSD-CONSENSUS G2Cdb.humanPSD G2Cdb.humanPSP CompositeSet Darnell FMRP targets Potential synaptic genes

Gene in Data Sources

Gene set name	Method of gene set	Description
CV:GWASdb	Genome-wide Association Studies	GWASdb records for schizophrenia
CV:PGCnp	Genome-wide Association Study	GWAS
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
ATP13A3	0.89	0.92
PCYOX1	0.88	0.93
ZBTB38	0.88	0.93
ARHGAP20	0.88	0.94
FAM160B1	0.86	0.92
EDEM3	0.86	0.91
GNAQ	0.86	0.91
CAMSAP1L1	0.85	0.92
NRXN1	0.85	0.92
SLC41A2	0.84	0.90

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
C11orf67	-0.59	-0.68
HSD17B14	-0.59	-0.69
FXYD1	-0.58	-0.68
EIF4EBP3	-0.58	-0.68
ACSF2	-0.57	-0.68
TLCD1	-0.57	-0.67
AF347015.31	-0.56	-0.67
HIGD1B	-0.56	-0.70
MT-CO2	-0.56	-0.68
RAB34	-0.56	-0.69

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005509	calcium ion binding	IEA		-
GO:0005244	voltage-gated ion channel activity	IEA		-
GO:0005245	voltage-gated calcium channel activity	TAS		8071363
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007268	synaptic transmission	TAS	neuron, Synap, Neurotransmitter (GO term level: 6)	8071363
GO:0006816	calcium ion transport	IEA		-
GO:0006811	ion transport	IEA		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0016021	integral to membrane	IEA		-
GO:0005886	plasma membrane	EXP		8825650
GO:0005891	voltage-gated calcium channel complex	TAS		8071363

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
KEGG MAPK SIGNALING PATHWAY	267	205	All SZGR 2.0 genes in this pathway
KEGG CALCIUM SIGNALING PATHWAY	178	134	All SZGR 2.0 genes in this pathway
KEGG TYPE II DIABETES MELLITUS	47	41	All SZGR 2.0 genes in this pathway
ENK UV RESPONSE KERATINOCYTE UP	530	342	All SZGR 2.0 genes in this pathway
HAMAI APOPTOSIS VIA TRAIL DN	186	107	All SZGR 2.0 genes in this pathway
DARWICHE SKIN TUMOR PROMOTER UP	142	96	All SZGR 2.0 genes in this pathway
DARWICHE PAPILLOMA RISK LOW UP	162	104	All SZGR 2.0 genes in this pathway
DARWICHE PAPILLOMA RISK HIGH UP	147	101	All SZGR 2.0 genes in this pathway
DARWICHE SQUAMOUS CELL CARCINOMA UP	146	104	All SZGR 2.0 genes in this pathway
SCHLOSSER SERUM RESPONSE DN	712	443	All SZGR 2.0 genes in this pathway
SHETH LIVER CANCER VS TXNIP LOSS PAM4	261	153	All SZGR 2.0 genes in this pathway
PUJANA BRCA1 PCC NETWORK	1652	1023	All SZGR 2.0 genes in this pathway
BENPORATH SUZ12 TARGETS	1038	678	All SZGR 2.0 genes in this pathway
BENPORATH EED TARGETS	1062	725	All SZGR 2.0 genes in this pathway
BENPORATH ES WITH H3K27ME3	1118	744	All SZGR 2.0 genes in this pathway
BENPORATH PRC2 TARGETS	652	441	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 16HR DN	86	62	All SZGR 2.0 genes in this pathway
RAMASWAMY METASTASIS DN	61	47	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 14HR DN	298	200	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 48HR DN	504	323	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 12HR DN	101	64	All SZGR 2.0 genes in this pathway
MARZEC IL2 SIGNALING DN	36	24	All SZGR 2.0 genes in this pathway
MIKKELSEN IPS WITH HCP H3K27ME3	102	76	All SZGR 2.0 genes in this pathway
MIKKELSEN ES HCP WITH H3K27ME3	41	30	All SZGR 2.0 genes in this pathway
MIKKELSEN MEF HCP WITH H3K27ME3	590	403	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 30MIN DN	150	99	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 1HR DN	222	147	All SZGR 2.0 genes in this pathway
BROWNE HCMV INFECTION 4HR DN	254	158	All SZGR 2.0 genes in this pathway
WANG RESPONSE TO GSK3 INHIBITOR SB216763 UP	397	206	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
let-7/98	1368	1374	1A	hsa-let-7a^brain	UGAGGUAGUAGGUUGUAUAGUU
				hsa-let-7b^brain	UGAGGUAGUAGGUUGUGUGGUU
				hsa-let-7c^brain	UGAGGUAGUAGGUUGUAUGGUU
				hsa-let-7d^brain	AGAGGUAGUAGGUUGCAUAGU
				hsa-let-7e^brain	UGAGGUAGGAGGUUGUAUAGU
				hsa-let-7f^brain	UGAGGUAGUAGAUUGUAUAGUU
				hsa-miR-98^brain	UGAGGUAGUAAGUUGUAUUGUU
				hsa-let-7g^SZ	UGAGGUAGUAGUUUGUACAGU
				hsa-let-7i^brain	UGAGGUAGUAGUUUGUGCUGU
miR-135	640	647	1A,m8	hsa-miR-135a	UAUGGCUUUUUAUUCCUAUGUGA
miR-135	640	647	1A,m8	hsa-miR-135b	UAUGGCUUUUCAUUCCUAUGUG
miR-138	440	446	m8	hsa-miR-138^brain	AGCUGGUGUUGUGAAUC
miR-143	493	499	1A	hsa-miR-143^brain	UGAGAUGAAGCACUGUAGCUCA
miR-182	2259	2265	1A	hsa-miR-182	UUUGGCAAUGGUAGAACUCACA
miR-183	207	213	1A	hsa-miR-183	UAUGGCACUGGUAGAAUUCACUG
miR-30-3p	1930	1936	1A	hsa-miR-30a-3p	CUUUCAGUCGGAUGUUUGCAGC
miR-30-3p	1930	1936	1A	hsa-miR-30e-3p	CUUUCAGUCGGAUGUUUACAGC
miR-320	2321	2327	m8	hsa-miR-320	AAAAGCUGGGUUGAGAGGGCGAA
miR-326	1500	1506	m8	hsa-miR-326	CCUCUGGGCCCUUCCUCCAG
miR-96	2259	2265	1A	hsa-miR-96^brain	UUUGGCACUAGCACAUUUUUGC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: CACNA1E