Gene Page: CNTNAP3

Summary
GeneID  79937
Symbol  CNTNAP3
Synonyms  CASPR3|CNTNAP3A|RP11-138L21.1|RP11-290L7.1
Description  contactin associated protein-like 3
See related  HGNC:13834|MIM:610517|Ensembl:ENSG00000106714|HPRD:10842|
Locus tag  RP11-204I2.1
Gene type  protein-coding
Map location  9p13.1
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005102receptor bindingIEANeurotransmitter (GO term level: 4)-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007155cell adhesionIEA-
GO:0007165signal transductionIEA-
GO:0008037cell recognitionNAS12093160 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005576extracellular regionIEA-
GO:0016021integral to membraneNAS12093160 
GO:0005886plasma membraneIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
APBA1D9S411E | MINT1 | X11 | X11A | X11ALPHAamyloid beta (A4) precursor protein-binding, family A, member 1-HPRD,BioGRID12093160 
 
Pathway annotation
Pathway namePathway size# SZGR genes in pathwayInfo
HOOI_ST7_TARGETS_DN 12378All SZGR genes in this pathway
BASAKI_YBX1_TARGETS_DN 384230All SZGR genes in this pathway
SENESE_HDAC3_TARGETS_UP 501327All SZGR genes in this pathway
PEREZ_TP53_TARGETS 1174695All SZGR genes in this pathway
KOYAMA_SEMA3B_TARGETS_UP 292168All SZGR genes in this pathway
BENPORATH_NANOG_TARGETS 988594All SZGR genes in this pathway
BENPORATH_OCT4_TARGETS 290172All SZGR genes in this pathway
GEORGES_TARGETS_OF_MIR192_AND_MIR215 893528All SZGR genes in this pathway
KONDO_EZH2_TARGETS 245148All SZGR genes in this pathway
KOINUMA_TARGETS_OF_SMAD2_OR_SMAD3 824528All SZGR genes in this pathway
GHANDHI_BYSTANDER_IRRADIATION_DN 1210All SZGR genes in this pathway
ZWANG_TRANSIENTLY_UP_BY_1ST_EGF_PULSE_ONLY 1839928All SZGR genes in this pathway
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-181725731m8hsa-miR-181abrainAACAUUCAACGCUGUCGGUGAGU
hsa-miR-181bSZAACAUUCAUUGCUGUCGGUGGG
hsa-miR-181cbrainAACAUUCAACCUGUCGGUGAGU
hsa-miR-181dbrainAACAUUCAUUGUUGUCGGUGGGUU
miR-5437267331A,m8hsa-miR-543AAACAUUCGCGGUGCACUUCU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.