SZGR2

Summary ?

GeneID	79937
Symbol	CNTNAP3
Synonyms	CASPR3\|CNTNAP3A
Description	contactin associated protein-like 3
Reference	MIM:610517\|HGNC:HGNC:13834\|Ensembl:ENSG00000106714\|HPRD:10842\|Vega:OTTHUMG00000019954
Gene type	protein-coding
Map location	9p13.1
Pascal p-value	0.051
Fetal beta	1.058
eGene	Cortex

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
PMID:cooccur	High-throughput literature-search	Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included.
Literature	High-throughput literature-search	Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias	Click to show details
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

No co-expressed genes in brain regions

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005102	receptor binding	IEA	Neurotransmitter (GO term level: 4)	-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0007155	cell adhesion	IEA		-
GO:0007165	signal transduction	IEA		-
GO:0008037	cell recognition	NAS		12093160
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005576	extracellular region	IEA		-
GO:0016021	integral to membrane	NAS		12093160
GO:0005886	plasma membrane	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
HOOI ST7 TARGETS DN	123	78	All SZGR 2.0 genes in this pathway
BASAKI YBX1 TARGETS DN	384	230	All SZGR 2.0 genes in this pathway
SENESE HDAC3 TARGETS UP	501	327	All SZGR 2.0 genes in this pathway
PEREZ TP53 TARGETS	1174	695	All SZGR 2.0 genes in this pathway
KOYAMA SEMA3B TARGETS UP	292	168	All SZGR 2.0 genes in this pathway
BENPORATH NANOG TARGETS	988	594	All SZGR 2.0 genes in this pathway
BENPORATH OCT4 TARGETS	290	172	All SZGR 2.0 genes in this pathway
GEORGES TARGETS OF MIR192 AND MIR215	893	528	All SZGR 2.0 genes in this pathway
KONDO EZH2 TARGETS	245	148	All SZGR 2.0 genes in this pathway
KOINUMA TARGETS OF SMAD2 OR SMAD3	824	528	All SZGR 2.0 genes in this pathway
GHANDHI BYSTANDER IRRADIATION DN	12	10	All SZGR 2.0 genes in this pathway
ZWANG TRANSIENTLY UP BY 1ST EGF PULSE ONLY	1839	928	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-181	725	731	m8	hsa-miR-181a^brain	AACAUUCAACGCUGUCGGUGAGU
				hsa-miR-181b^SZ	AACAUUCAUUGCUGUCGGUGGG
				hsa-miR-181c^brain	AACAUUCAACCUGUCGGUGAGU
				hsa-miR-181d^brain	AACAUUCAUUGUUGUCGGUGGGUU
miR-543	726	733	1A,m8	hsa-miR-543	AAACAUUCGCGGUGCACUUCU

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: CNTNAP3