Gene Page: RGS9
Summary ?
| GeneID | 8787 |
| Symbol | RGS9 |
| Synonyms | PERRS|RGS9L |
| Description | regulator of G-protein signaling 9 |
| Reference | MIM:604067|HGNC:HGNC:10004|Ensembl:ENSG00000108370|HPRD:04962|Vega:OTTHUMG00000179349 |
| Gene type | protein-coding |
| Map location | 17q24.1 |
| Pascal p-value | 0.458 |
| Fetal beta | -0.273 |
Gene in Data Sources
| Gene set name | Method of gene set | Description | Info |
|---|---|---|---|
| CV:PGCnp | Genome-wide Association Study | GWAS | |
| PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
| Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenic,schizophrenias | Click to show details |
Section I. Genetics and epigenetics annotation
Section II. Transcriptome annotation
General gene expression (GTEx)
Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
Top co-expressed genes in brain regions
| Top 10 positively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| LMTK2 | 0.91 | 0.91 |
| AP000751.3 | 0.88 | 0.88 |
| BSN | 0.88 | 0.89 |
| C17orf51 | 0.87 | 0.88 |
| KALRN | 0.87 | 0.88 |
| TLN2 | 0.87 | 0.87 |
| SPRED2 | 0.87 | 0.89 |
| FMN2 | 0.87 | 0.88 |
| MEF2D | 0.86 | 0.88 |
| ZC3H12B | 0.86 | 0.86 |
| Top 10 negatively co-expressed genes | ||
| Gene | Pearson's Correlation | Spearman's Correlation |
| DBI | -0.52 | -0.59 |
| C1orf54 | -0.50 | -0.62 |
| RHOC | -0.50 | -0.57 |
| GNG11 | -0.49 | -0.56 |
| AF347015.21 | -0.48 | -0.51 |
| AL139819.3 | -0.46 | -0.52 |
| SYCP3 | -0.45 | -0.57 |
| C1orf61 | -0.45 | -0.52 |
| VAMP5 | -0.44 | -0.47 |
| RPS27L | -0.44 | -0.47 |
Section III. Gene Ontology annotation
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|---|---|---|---|
| GO:0004871 | signal transducer activity | IEA | - | |
| GO:0005096 | GTPase activator activity | TAS | 9765512 | |
| GO:0005515 | protein binding | IEA | - | |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0009968 | negative regulation of signal transduction | IEA | - | |
| GO:0007242 | intracellular signaling cascade | IEA | - | |
| GO:0008277 | regulation of G-protein coupled receptor protein signaling pathway | TAS | 9765512 | |
| GO:0007601 | visual perception | IEA | - | |
| GO:0050896 | response to stimulus | IEA | - | |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
| GO:0005834 | heterotrimeric G-protein complex | IEA | - | |
| GO:0016020 | membrane | IEA | - |
Section V. Pathway annotation
| Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
|---|---|---|---|
| PID CONE PATHWAY | 23 | 8 | All SZGR 2.0 genes in this pathway |
| PID RHODOPSIN PATHWAY | 24 | 10 | All SZGR 2.0 genes in this pathway |
| REACTOME SIGNALING BY GPCR | 920 | 449 | All SZGR 2.0 genes in this pathway |
| REACTOME GPCR DOWNSTREAM SIGNALING | 805 | 368 | All SZGR 2.0 genes in this pathway |
| REACTOME G ALPHA I SIGNALLING EVENTS | 195 | 114 | All SZGR 2.0 genes in this pathway |
| ZHONG RESPONSE TO AZACITIDINE AND TSA UP | 183 | 119 | All SZGR 2.0 genes in this pathway |
| SENESE HDAC3 TARGETS DN | 536 | 332 | All SZGR 2.0 genes in this pathway |
| BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
| NIKOLSKY BREAST CANCER 17Q21 Q25 AMPLICON | 335 | 181 | All SZGR 2.0 genes in this pathway |
| OKUMURA INFLAMMATORY RESPONSE LPS | 183 | 115 | All SZGR 2.0 genes in this pathway |
| KUMAR TARGETS OF MLL AF9 FUSION | 405 | 264 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE INCIPIENT UP | 390 | 242 | All SZGR 2.0 genes in this pathway |
| IVANOVA HEMATOPOIESIS LATE PROGENITOR | 544 | 307 | All SZGR 2.0 genes in this pathway |
| BLALOCK ALZHEIMERS DISEASE UP | 1691 | 1088 | All SZGR 2.0 genes in this pathway |
| YOSHIMURA MAPK8 TARGETS UP | 1305 | 895 | All SZGR 2.0 genes in this pathway |
| RAO BOUND BY SALL4 ISOFORM A | 182 | 108 | All SZGR 2.0 genes in this pathway |
| GHANDHI DIRECT IRRADIATION UP | 110 | 68 | All SZGR 2.0 genes in this pathway |
| GHANDHI BYSTANDER IRRADIATION UP | 86 | 54 | All SZGR 2.0 genes in this pathway |
| ZWANG TRANSIENTLY UP BY 2ND EGF PULSE ONLY | 1725 | 838 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
| miRNA family | Target position | miRNA ID | miRNA seq | ||
|---|---|---|---|---|---|
| UTR start | UTR end | Match method | |||
| miR-124.1 | 255 | 262 | 1A,m8 | hsa-miR-124a | UUAAGGCACGCGGUGAAUGCCA |
| miR-124/506 | 255 | 261 | 1A | hsa-miR-506 | UAAGGCACCCUUCUGAGUAGA |
| hsa-miR-124brain | UAAGGCACGCGGUGAAUGCC | ||||
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.