SZGR2

Summary ?

GeneID	8861
Symbol	LDB1
Synonyms	CLIM2\|NLI
Description	LIM domain binding 1
Reference	MIM:603451\|HGNC:HGNC:6532\|Ensembl:ENSG00000198728\|HPRD:09144\|Vega:OTTHUMG00000018950
Gene type	protein-coding
Map location	10q24-q25
Pascal p-value	8.076E-4
Fetal beta	-0.441
DMG	1 (# studies)

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:Wockner_2014	Genome-wide DNA methylation analysis	This dataset includes 4641 differentially methylated probes corresponding to 2929 unique genes between schizophrenia patients (n=24) and controls (n=24).	1
GO_Annotation	Mapping neuro-related keywords to Gene Ontology annotations	Hits with neuro-related keywords: 1

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg17915961	10	103881480	LDB1	5.404E-4	0.467	0.048	DMG:Wockner_2014

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
SMPD4	0.95	0.95
TSC2	0.95	0.95
CIZ1	0.94	0.93
PPRC1	0.94	0.94
EDC4	0.94	0.95
PPIL2	0.93	0.93
DHX34	0.93	0.92
KIAA0892	0.93	0.93
MAST2	0.93	0.92
AC145098.2	0.93	0.93

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
AF347015.31	-0.76	-0.86
AF347015.27	-0.74	-0.84
MT-CO2	-0.74	-0.85
AF347015.8	-0.72	-0.84
MT-CYB	-0.72	-0.82
AF347015.33	-0.72	-0.80
AF347015.21	-0.70	-0.91
AF347015.15	-0.69	-0.81
HIGD1B	-0.68	-0.79
C5orf53	-0.68	-0.70

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0003714	transcription corepressor activity	TAS		9391090
GO:0030274	LIM domain binding	IPI		12792813
GO:0030274	LIM domain binding	ISS		-
GO:0042803	protein homodimerization activity	ISS		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0030182	neuron differentiation	ISS	neuron (GO term level: 8)	-
GO:0007275	multicellular organismal development	NAS		12792813
GO:0045647	negative regulation of erythrocyte differentiation	ISS		-
GO:0045892	negative regulation of transcription, DNA-dependent	IDA		10767331
GO:0045892	negative regulation of transcription, DNA-dependent	ISS		-
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005634	nucleus	ISS		-
GO:0043234	protein complex	ISS		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
BIOCARTA PITX2 PATHWAY	15	15	All SZGR 2.0 genes in this pathway
HUTTMANN B CLL POOR SURVIVAL UP	276	187	All SZGR 2.0 genes in this pathway
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP	1382	904	All SZGR 2.0 genes in this pathway
RODRIGUES THYROID CARCINOMA POORLY DIFFERENTIATED UP	633	376	All SZGR 2.0 genes in this pathway
PEREZ TP53 TARGETS	1174	695	All SZGR 2.0 genes in this pathway
SPIELMAN LYMPHOBLAST EUROPEAN VS ASIAN UP	479	299	All SZGR 2.0 genes in this pathway
YAGI AML FAB MARKERS	191	131	All SZGR 2.0 genes in this pathway
LEE CALORIE RESTRICTION NEOCORTEX UP	83	66	All SZGR 2.0 genes in this pathway
MEDINA SMARCA4 TARGETS	44	29	All SZGR 2.0 genes in this pathway
KIM GASTRIC CANCER CHEMOSENSITIVITY	103	64	All SZGR 2.0 genes in this pathway
MARSON BOUND BY FOXP3 UNSTIMULATED	1229	713	All SZGR 2.0 genes in this pathway
SANSOM APC MYC TARGETS	217	138	All SZGR 2.0 genes in this pathway
SANSOM APC TARGETS REQUIRE MYC	210	123	All SZGR 2.0 genes in this pathway
SANSOM WNT PATHWAY REQUIRE MYC	58	43	All SZGR 2.0 genes in this pathway
IWANAGA CARCINOGENESIS BY KRAS PTEN UP	181	112	All SZGR 2.0 genes in this pathway
SAGIV CD24 TARGETS UP	23	15	All SZGR 2.0 genes in this pathway
SAGIV CD24 TARGETS DN	46	26	All SZGR 2.0 genes in this pathway
CHANG CORE SERUM RESPONSE DN	209	137	All SZGR 2.0 genes in this pathway
YAGI AML WITH 11Q23 REARRANGED	351	238	All SZGR 2.0 genes in this pathway
PEDRIOLI MIR31 TARGETS UP	221	120	All SZGR 2.0 genes in this pathway
RAO BOUND BY SALL4 ISOFORM B	517	302	All SZGR 2.0 genes in this pathway
RAO BOUND BY SALL4	227	149	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
miR-125/351	121	127	1A	hsa-miR-125b^brain	UCCCUGAGACCCUAACUUGUGA
miR-125/351	121	127	1A	hsa-miR-125a^brain	UCCCUGAGACCCUUUAACCUGUG
miR-365	282	288	m8	hsa-miR-365	UAAUGCCCCUAAAAAUCCUUAU
miR-96	151	157	m8	hsa-miR-96^brain	UUUGGCACUAGCACAUUUUUGC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: LDB1