Gene Page: WNT3A
Summary ?
GeneID | 89780 |
Symbol | WNT3A |
Synonyms | - |
Description | wingless-type MMTV integration site family member 3A |
Reference | MIM:606359|HGNC:HGNC:15983|Ensembl:ENSG00000154342|HPRD:05897|Vega:OTTHUMG00000037593 |
Gene type | protein-coding |
Map location | 1q42 |
Fetal beta | -0.068 |
DMG | 1 (# studies) |
Gene in Data Sources
Gene set name | Method of gene set | Description | Info |
---|---|---|---|
CV:PGCnp | Genome-wide Association Study | GWAS | |
DMG:Jaffe_2016 | Genome-wide DNA methylation analysis | This dataset includes 2,104 probes/CpGs associated with SZ patients (n=108) compared to 136 controls at Bonferroni-adjusted P < 0.05. | 1 |
PMID:cooccur | High-throughput literature-search | Systematic search in PubMed for genes co-occurring with SCZ keywords. A total of 3027 genes were included. | |
Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: schizophrenia,schizophrenias | Click to show details |
GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 1 |
Section I. Genetics and epigenetics annotation
Differentially methylated gene
Probe | Chromosome | Position | Nearest gene | P (dis) | Beta (dis) | FDR (dis) | Study |
---|---|---|---|---|---|---|---|
cg01313514 | 1 | 228194916 | WNT3A | 8.84E-10 | -0.019 | 1.1E-6 | DMG:Jaffe_2016 |
Section II. Transcriptome annotation
General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)
Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.
Gene expression of temporal and spatial changes (BrainSpan)
Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.
No co-expressed genes in brain regions
Section III. Gene Ontology annotation
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|---|---|---|---|
GO:0004871 | signal transducer activity | IEA | - | |
GO:0005515 | protein binding | IEA | - | |
GO:0005201 | extracellular matrix structural constituent | NAS | - | |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0007409 | axonogenesis | IEA | neuron, axon, neurite (GO term level: 12) | - |
GO:0001756 | somitogenesis | IEA | - | |
GO:0001701 | in utero embryonic development | IEA | - | |
GO:0001947 | heart looping | IEA | - | |
GO:0007368 | determination of left/right symmetry | IEA | - | |
GO:0007267 | cell-cell signaling | NAS | - | |
GO:0007223 | Wnt receptor signaling pathway, calcium modulating pathway | IEA | - | |
GO:0048103 | somatic stem cell division | IEA | - | |
GO:0007275 | multicellular organismal development | IEA | - | |
GO:0048343 | paraxial mesodermal cell fate commitment | IEA | - | |
GO:0042472 | inner ear morphogenesis | IEA | - | |
GO:0030879 | mammary gland development | IEA | - | |
GO:0030097 | hemopoiesis | IEA | - | |
GO:0045595 | regulation of cell differentiation | IEA | - | |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
GO:0005576 | extracellular region | IEA | - | |
GO:0005576 | extracellular region | NAS | - | |
GO:0005578 | proteinaceous extracellular matrix | IEA | - | |
GO:0005615 | extracellular space | IEA | - |
Section V. Pathway annotation
Pathway name | Pathway size | # SZGR 2.0 genes in pathway | Info |
---|---|---|---|
KEGG WNT SIGNALING PATHWAY | 151 | 112 | All SZGR 2.0 genes in this pathway |
KEGG HEDGEHOG SIGNALING PATHWAY | 56 | 42 | All SZGR 2.0 genes in this pathway |
KEGG MELANOGENESIS | 102 | 80 | All SZGR 2.0 genes in this pathway |
KEGG PATHWAYS IN CANCER | 328 | 259 | All SZGR 2.0 genes in this pathway |
KEGG BASAL CELL CARCINOMA | 55 | 44 | All SZGR 2.0 genes in this pathway |
WNT SIGNALING | 89 | 71 | All SZGR 2.0 genes in this pathway |
PID BETA CATENIN DEG PATHWAY | 18 | 17 | All SZGR 2.0 genes in this pathway |
PID WNT SIGNALING PATHWAY | 28 | 23 | All SZGR 2.0 genes in this pathway |
PID WNT CANONICAL PATHWAY | 20 | 18 | All SZGR 2.0 genes in this pathway |
REACTOME SIGNALING BY GPCR | 920 | 449 | All SZGR 2.0 genes in this pathway |
REACTOME CLASS B 2 SECRETIN FAMILY RECEPTORS | 88 | 58 | All SZGR 2.0 genes in this pathway |
REACTOME GPCR LIGAND BINDING | 408 | 246 | All SZGR 2.0 genes in this pathway |
HWANG PROSTATE CANCER MARKERS | 28 | 19 | All SZGR 2.0 genes in this pathway |
MARTORIATI MDM4 TARGETS NEUROEPITHELIUM UP | 176 | 111 | All SZGR 2.0 genes in this pathway |
BENPORATH SUZ12 TARGETS | 1038 | 678 | All SZGR 2.0 genes in this pathway |
BENPORATH EED TARGETS | 1062 | 725 | All SZGR 2.0 genes in this pathway |
BENPORATH ES WITH H3K27ME3 | 1118 | 744 | All SZGR 2.0 genes in this pathway |
BENPORATH PRC2 TARGETS | 652 | 441 | All SZGR 2.0 genes in this pathway |
SHIN B CELL LYMPHOMA CLUSTER 8 | 36 | 28 | All SZGR 2.0 genes in this pathway |
BONCI TARGETS OF MIR15A AND MIR16 1 | 91 | 75 | All SZGR 2.0 genes in this pathway |
MEISSNER BRAIN HCP WITH H3K27ME3 | 269 | 159 | All SZGR 2.0 genes in this pathway |
MEISSNER NPC HCP WITH H3K4ME2 AND H3K27ME3 | 349 | 234 | All SZGR 2.0 genes in this pathway |
MIKKELSEN MCV6 HCP WITH H3K27ME3 | 435 | 318 | All SZGR 2.0 genes in this pathway |
MIKKELSEN NPC HCP WITH H3K27ME3 | 341 | 243 | All SZGR 2.0 genes in this pathway |
MIKKELSEN MEF HCP WITH H3K27ME3 | 590 | 403 | All SZGR 2.0 genes in this pathway |
NABA SECRETED FACTORS | 344 | 197 | All SZGR 2.0 genes in this pathway |
NABA MATRISOME ASSOCIATED | 753 | 411 | All SZGR 2.0 genes in this pathway |
NABA MATRISOME | 1028 | 559 | All SZGR 2.0 genes in this pathway |
Section VI. microRNA annotation
miRNA family | Target position | miRNA ID | miRNA seq | ||
---|---|---|---|---|---|
UTR start | UTR end | Match method | |||
miR-103/107 | 1770 | 1776 | m8 | hsa-miR-103brain | AGCAGCAUUGUACAGGGCUAUGA |
hsa-miR-107brain | AGCAGCAUUGUACAGGGCUAUCA | ||||
miR-128 | 1636 | 1643 | 1A,m8 | hsa-miR-128a | UCACAGUGAACCGGUCUCUUUU |
hsa-miR-128b | UCACAGUGAACCGGUCUCUUUC | ||||
miR-15/16/195/424/497 | 1771 | 1778 | 1A,m8 | hsa-miR-15abrain | UAGCAGCACAUAAUGGUUUGUG |
hsa-miR-16brain | UAGCAGCACGUAAAUAUUGGCG | ||||
hsa-miR-15bbrain | UAGCAGCACAUCAUGGUUUACA | ||||
hsa-miR-195SZ | UAGCAGCACAGAAAUAUUGGC | ||||
hsa-miR-424 | CAGCAGCAAUUCAUGUUUUGAA | ||||
hsa-miR-497 | CAGCAGCACACUGUGGUUUGU | ||||
miR-27 | 1637 | 1644 | 1A,m8 | hsa-miR-27abrain | UUCACAGUGGCUAAGUUCCGC |
hsa-miR-27bbrain | UUCACAGUGGCUAAGUUCUGC | ||||
miR-503 | 1772 | 1778 | 1A | hsa-miR-503 | UAGCAGCGGGAACAGUUCUGCAG |
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.